rs1064792974

Variant names:

• chr13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C
• rs1064792974
• NM_000321.3:c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_000321.3(RB1):​c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC​(p.Ala13ThrfsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.49

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1-DT (HGNC:42778): (RB1 divergent transcript)

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 217 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C is Pathogenic according to our data. Variant chr13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C is described in ClinVar as [Pathogenic]. Clinvar id is 410951.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RB1	NM_000321.3	c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift_variant	Exon 1 of 27	ENST00000267163.6	NP_000312.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RB1	ENST00000267163.6	c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift_variant	Exon 1 of 27	1	NM_000321.3	ENSP00000267163.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Retinoblastoma Pathogenic:1

May 25, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Loss-of-function variants in RB1 are known to be pathogenic (PMID: 17096365). This variant has not been reported in the literature in individuals with RB1-related disease. ClinVar contains an entry for this variant (Variation ID: 410951). This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Ala13Thrfs*8) in the RB1 gene. It is expected to result in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792974; hg19: chr13-48878083;