rs1064792974

Variant names:

• chr13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C
• rs1064792974
• NM_000321.3:c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000321.3(RB1):​c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC​(p.Ala13ThrfsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A13A) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: RB1 NM_000321.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 1.49
• Publications: 1 publications found

Genes affected

RB1 (HGNC:9884): (RB transcriptional corepressor 1) The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]

RB1-DT (HGNC:42778): (RB1 divergent transcript)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 667 pathogenic variants in the truncated region.
• PP5: Variant 13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C is Pathogenic according to our data. Variant chr13-48303947-CCGCCGCCGCTGCCGCCGCGGAACCCCCGG-C is described in ClinVar as Pathogenic. ClinVar VariationId is 410951.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000321.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	NM_000321.3	MANE Select	c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift	Exon 1 of 27	NP_000312.2
	RB1	NM_001407165.1		c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift	Exon 1 of 27	NP_001394094.1
	RB1	NM_001407166.1		c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift	Exon 1 of 17	NP_001394095.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RB1	ENST00000267163.6	TSL:1 MANE Select	c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift	Exon 1 of 27	ENSP00000267163.4
	RB1	ENST00000467505.6	TSL:1	n.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC		non_coding_transcript_exon	Exon 1 of 22	ENSP00000434702.1
	RB1	ENST00000650461.1		c.37_65delGCCGCCGCTGCCGCCGCGGAACCCCCGGC	p.Ala13ThrfsTer8	frameshift	Exon 1 of 27	ENSP00000497193.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Retinoblastoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5
Mutation Taster		=2/198	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064792974; hg19: chr13-48878083;