rs1064792984

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_006772.3(SYNGAP1):​c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC​(p.Gln702_Lys705del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 31)

Consequence

SYNGAP1
NM_006772.3 splice_donor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.32
Variant links:
Genes affected
SYNGAP1 (HGNC:11497): (synaptic Ras GTPase activating protein 1) This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Allelic variants of this gene are associated with intellectual disability and autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
SYNGAP1-AS1 (HGNC:53831): (SYNGAP1 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 6-33441359-GCCCCAGCTCAGCAAGGTCAGCAGATC-G is Pathogenic according to our data. Variant chr6-33441359-GCCCCAGCTCAGCAAGGTCAGCAGATC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 411590.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SYNGAP1NM_006772.3 linkc.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC p.Gln702_Lys705del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 19 ENST00000646630.1 NP_006763.2 Q96PV0-1A0A1U9X8L0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SYNGAP1ENST00000646630.1 linkc.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC p.Pro701_Lys705del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 19 NM_006772.3 ENSP00000496007.1 Q96PV0-1
SYNGAP1ENST00000644458.1 linkc.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC p.Pro701_Lys705del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 19 ENSP00000495541.1 A0A2R8Y6T2
SYNGAP1ENST00000449372.7 linkc.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC p.Pro701_Lys705del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 18 5 ENSP00000416519.4 B7ZCA0
SYNGAP1ENST00000418600.7 linkc.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC p.Pro701_Lys705del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 12 of 19 5 ENSP00000403636.3 Q96PV0-2
SYNGAP1ENST00000645250.1 linkc.1924_1938+11delCCCCAGCTCAGCAAGGTCAGCAGATC p.Pro642_Lys646del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 10 of 17 ENSP00000494861.1 A0A2R8YDS2

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Intellectual disability, autosomal dominant 5 Pathogenic:1
May 25, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Loss-of-function variants in SYNGAP1 are known to be pathogenic (PMID: 23161826, 23708187, 26989088). This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. ClinVar contains an entry for this variant (Variation ID: 411590). This variant is a deletion of the genomic region encompassing part of exon 12 (c.2104_2115+14del) of the SYNGAP1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1064792984; hg19: chr6-33409136; API