rs1064792984

Variant names:

• chr6-33441359-GCCCCAGCTCAGCAAGGTCAGCAGATC-G
• rs1064792984
• NM_006772.3:c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_006772.3(SYNGAP1):​c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC​(p.Gln702_Lys705del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: SYNGAP1 NM_006772.3 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.32

Genes affected

SYNGAP1 (HGNC:11497): (synaptic Ras GTPase activating protein 1) This gene encodes a Ras GTPase activating protein that is a member of the N-methyl-D-aspartate receptor complex. The N-terminal domain of the protein contains a Ras-GAP domain, a pleckstrin homology domain, and a C2 domain that may be involved in binding of calcium and phospholipids. The C-terminal domain consists of a ten histidine repeat region, serine and tyrosine phosphorylation sites, and a T/SXV motif required for postsynaptic scaffold protein interaction. The encoded protein negatively regulates Ras, Rap and alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor trafficking to the postsynaptic membrane to regulate synaptic plasticity and neuronal homeostasis. Allelic variants of this gene are associated with intellectual disability and autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]

SYNGAP1-AS1 (HGNC:53831): (SYNGAP1 antisense RNA 1)

ACMG classification

Verdict is Pathogenic. Variant got 12 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-33441359-GCCCCAGCTCAGCAAGGTCAGCAGATC-G is Pathogenic according to our data. Variant chr6-33441359-GCCCCAGCTCAGCAAGGTCAGCAGATC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 411590.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SYNGAP1	NM_006772.3	c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC	p.Gln702_Lys705del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 19	ENST00000646630.1	NP_006763.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SYNGAP1	ENST00000646630.1	c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC	p.Pro701_Lys705del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 19		NM_006772.3	ENSP00000496007.1
SYNGAP1	ENST00000644458.1	c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC	p.Pro701_Lys705del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 19			ENSP00000495541.1
SYNGAP1	ENST00000449372.7	c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC	p.Pro701_Lys705del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 18	5		ENSP00000416519.4
SYNGAP1	ENST00000418600.7	c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC	p.Pro701_Lys705del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 12 of 19	5		ENSP00000403636.3
SYNGAP1	ENST00000645250.1	c.1924_1938+11delCCCCAGCTCAGCAAGGTCAGCAGATC	p.Pro642_Lys646del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 10 of 17			ENSP00000494861.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Intellectual disability, autosomal dominant 5 Pathogenic:1

May 25, 2019

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. Loss-of-function variants in SYNGAP1 are known to be pathogenic (PMID: 23161826, 23708187, 26989088). This variant has not been reported in the literature in individuals with SYNGAP1-related conditions. ClinVar contains an entry for this variant (Variation ID: 411590). This variant is a deletion of the genomic region encompassing part of exon 12 (c.2104_2115+14del) of the SYNGAP1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064792984; hg19: chr6-33409136;