rs1064792984
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_006772.3(SYNGAP1):c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC(p.Gln702_Lys705del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).
Frequency
Consequence
NM_006772.3 splice_donor, conservative_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006772.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SYNGAP1 | MANE Select | c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC | p.Gln702_Lys705del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 19 | NP_006763.2 | A0A1U9X8L0 | ||
| SYNGAP1 | c.2104_2115+14delCAGCTCAGCAAGGTCAGCAGATCCCC | p.Gln702_Lys705del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 18 | NP_001123538.1 | B7ZCA0 | |||
| SYNGAP1-AS1 | n.330-3904_330-3879delGATCTGCTGACCTTGCTGAGCTGGGG | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SYNGAP1 | MANE Select | c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC | p.Pro701_Lys705del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 19 | ENSP00000496007.1 | Q96PV0-1 | ||
| SYNGAP1 | c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC | p.Pro701_Lys705del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 19 | ENSP00000495541.1 | A0A2R8Y6T2 | |||
| SYNGAP1 | TSL:5 | c.2101_2115+11delCCCCAGCTCAGCAAGGTCAGCAGATC | p.Pro701_Lys705del | splice_donor conservative_inframe_deletion splice_region intron | Exon 12 of 18 | ENSP00000416519.4 | B7ZCA0 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at