rs1064792990
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001122630.2(CDKN1C):c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC(p.Ala188_Pro199del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000114 in 879,570 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. P187P) has been classified as Likely benign.
Frequency
Consequence
NM_001122630.2 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Beckwith-Wiedemann syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- IMAGe syndromeInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, Illumina
- rhabdomyosarcomaInheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- Beckwith-Wiedemann syndrome due to CDKN1C mutationInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- intrauterine growth restriction-short stature-early adult-onset diabetes syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Silver-Russell syndromeInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001122630.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | MANE Select | c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala188_Pro199del | disruptive_inframe_deletion | Exon 2 of 4 | NP_001116102.1 | P49918-2 | ||
| CDKN1C | c.594_629delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala199_Pro210del | disruptive_inframe_deletion | Exon 1 of 3 | NP_000067.1 | P49918-1 | |||
| CDKN1C | c.594_629delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala199_Pro210del | disruptive_inframe_deletion | Exon 1 of 3 | NP_001349403.1 | P49918-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CDKN1C | TSL:1 MANE Select | c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala188_Pro199del | disruptive_inframe_deletion | Exon 2 of 4 | ENSP00000411257.2 | P49918-2 | ||
| CDKN1C | TSL:1 | c.594_629delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala199_Pro210del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000413720.3 | P49918-1 | ||
| CDKN1C | TSL:1 | c.594_629delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC | p.Ala199_Pro210del | disruptive_inframe_deletion | Exon 1 of 3 | ENSP00000411552.2 | P49918-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome AF: 0.00000114 AC: 1AN: 879570Hom.: 0 AF XY: 0.00000241 AC XY: 1AN XY: 415602 show subpopulations
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at