rs1064792990

Variant names:

• chr11-2884860-GGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCC-G
• NM_001122630.2:c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC

Your query was ambiguous. Multiple possible variants found:

• chr11-2884860-GGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCC-G
• chr11-2884860-GGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCC-GGGGGCC
• chr11-2884860-GGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCC-GGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCCGGGGCCGGGGCCGGGGCCGGGGCTGGGGCC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001122630.2(CDKN1C):​c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC​(p.Ala188_Pro199del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000114 in 879,570 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000011 (0 hom.)
• Consequence: CDKN1C NM_001122630.2 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.91

Genes affected

CDKN1C (HGNC:1786): (cyclin dependent kinase inhibitor 1C) This gene is imprinted, with preferential expression of the maternal allele. The encoded protein is a tight-binding, strong inhibitor of several G1 cyclin/Cdk complexes and a negative regulator of cell proliferation. Mutations in this gene are implicated in sporadic cancers and Beckwith-Wiedemann syndorome, suggesting that this gene is a tumor suppressor candidate. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CDKN1C	NM_001122630.2	c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC	p.Ala188_Pro199del	disruptive_inframe_deletion	Exon 2 of 4	ENST00000440480.8	NP_001116102.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CDKN1C	ENST00000440480.8	c.561_596delGGCCCCAGCCCCGGCCCCGGCCCCGGCCCCGGCCCC	p.Ala188_Pro199del	disruptive_inframe_deletion	Exon 2 of 4	1	NM_001122630.2	ENSP00000411257.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000114 AC: 1 AN: 879570 Hom.: 0 AF XY: 0.00000241 AC XY: 1 AN XY: 415602

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000130

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr11-2906090;