rs1064794411

Variant names:

• chr1-45329351-AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC-A
• rs1064794411
• NM_001048174.2:c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_Moderate PM2

The NM_001048174.2(MUTYH):​c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC​(p.Arg491LeufsTer36) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R491R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MUTYH NM_001048174.2 frameshift
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.59

Genes affected

MUTYH (HGNC:7527): (mutY DNA glycosylase) This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]

ENSG00000288208 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.06 CDS is truncated, and there are 1 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MUTYH	NM_001048174.2	c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg491LeufsTer36	frameshift_variant	Exon 16 of 16	ENST00000456914.7	NP_001041639.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MUTYH	ENST00000456914.7	c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg491LeufsTer36	frameshift_variant	Exon 16 of 16	1	NM_001048174.2	ENSP00000407590.2
ENSG00000288208	ENST00000671898.1	n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC		non_coding_transcript_exon_variant	Exon 21 of 21			ENSP00000499896.1
ENSG00000288208	ENST00000671898.1	n.*215_*263delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC		3_prime_UTR_variant	Exon 21 of 21			ENSP00000499896.1

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Uncertain:1

Dec 28, 2015

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This deletion of 49 nucleotides in MUTYH is denoted c.1556_1604del49 at the cDNA level and p.Arg519LeufsX36 (R519LfsX36) at the protein level. The surrounding sequence is AGTC[del49]TCAC. The deletion causes a frameshift, which changes an Arginine to a Leucine at codon 519, and creates a premature stop codon at position 36 of the new reading frame. As this deletion is in the last exon of the gene, nonsense mediated decay is not expected to occur. This variant has not, to our knowledge, been reported in the literature. Based on currently available information, it is unclear whether this deletion is a pathogenic variant or a benign variant. We consider it to be a variant of uncertain significance. -

Familial adenomatous polyposis 2 Uncertain:1

Jul 17, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change results in a premature translational stop signal in the MUTYH gene (p.Arg519Leufs*36). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 31 amino acids of the MUTYH protein. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MUTYH-related disease. ClinVar contains an entry for this variant (Variation ID: 420317). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Hereditary cancer-predisposing syndrome Uncertain:1

Mar 04, 2022

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1556_1604del49 variant, located in coding exon 16 of the MUTYH gene, results from a deletion of 49 nucleotides at nucleotide positions 1556 to 1604, causing a translational frameshift with a predicted alternate stop codon (p.R519Lfs*36). This alteration occurs at the 3' terminus of theMUTYH gene, is not expected to trigger nonsense-mediated mRNAdecay and results in the elongation of the protein by 4 amino acids. This frameshift impacts the last 31amino acids of the native protein. The exact functional effect of the altered amino acids is unknown. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1064794411; hg19: chr1-45795023;