rs1064794411

Variant names:

• chr1-45329351-AGACCGAAAGAAATTATCCAGGACTTGCTGGCCCATGCGGGGCTTTTTCC-A
• rs1064794411
• NM_001128425.2:c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Strong

The NM_001128425.2(MUTYH):​c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC​(p.Arg519LeufsTer36) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. R519R) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 31)
• Consequence: MUTYH NM_001128425.2 frameshift
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:3
• Conservation: PhyloP100: 3.59
• Publications: 0 publications found

Genes affected

MUTYH (HGNC:7527): (mutY DNA glycosylase) This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]

MUTYH Gene-Disease associations (from GenCC):

• familial adenomatous polyposis 2

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P
• colorectal cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD, AR Classification: NO_KNOWN Submitted by: ClinGen
• hereditary breast carcinoma

  Inheritance: AD, AR Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000288208 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 8 pathogenic variants in the truncated region.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001128425.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MUTYH	NM_001128425.2	MANE Plus Clinical	c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg519LeufsTer36	frameshift	Exon 16 of 16	NP_001121897.1
	MUTYH	NM_001048174.2	MANE Select	c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg491LeufsTer36	frameshift	Exon 16 of 16	NP_001041639.1
	MUTYH	NM_012222.3		c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg516LeufsTer36	frameshift	Exon 16 of 16	NP_036354.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MUTYH	ENST00000710952.2	MANE Plus Clinical	c.1556_1604delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg519LeufsTer36	frameshift	Exon 16 of 16	ENSP00000518552.2
	MUTYH	ENST00000456914.7	TSL:1 MANE Select	c.1472_1520delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg491LeufsTer36	frameshift	Exon 16 of 16	ENSP00000407590.2
	MUTYH	ENST00000372098.7	TSL:1	c.1547_1595delGGAAAAAGCCCCGCATGGGCCAGCAAGTCCTGGATAATTTCTTTCGGTC	p.Arg516LeufsTer36	frameshift	Exon 16 of 16	ENSP00000361170.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Familial adenomatous polyposis 2 (1)
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064794411; hg19: chr1-45795023;