rs1064795151

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 2P and 2B. PM2BP6_Moderate

The NM_001204526.1(SSR4):​c.20-38_20-12dupCCCTCGTGTTCATGGGAGCTCGTTTTC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely benign (★).

Frequency

Genomes: not found (cov: 26)

Consequence

SSR4
NM_001204526.1 intron

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 0.377
Variant links:
Genes affected
SSR4 (HGNC:11326): (signal sequence receptor subunit 4) This gene encodes the delta subunit of the translocon-associated protein complex which is involved in translocating proteins across the endoplasmic reticulum membrane. The encoded protein is located in the Xq28 region and is arranged in a compact head-to-head manner with the isocitrate dehydrogenase 3 (NAD+) gamma gene and both genes are driven by a CpG-embedded bidirectional promoter. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2011]
IDH3G (HGNC:5386): (isocitrate dehydrogenase (NAD(+)) 3 non-catalytic subunit gamma) Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 0 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
BP6
Variant X-153794634-G-GCCCCTCGTGTTCATGGGAGCTCGTTTT is Benign according to our data. Variant chrX-153794634-G-GCCCCTCGTGTTCATGGGAGCTCGTTTT is described in ClinVar as [Likely_benign]. Clinvar id is 421458.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SSR4NM_006280.3 linkc.-54_-53insCCCCTCGTGTTCATGGGAGCTCGTTTT upstream_gene_variant ENST00000370086.8 NP_006271.1 P51571

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SSR4ENST00000370086.8 linkc.-54_-53insCCCCTCGTGTTCATGGGAGCTCGTTTT upstream_gene_variant 1 NM_006280.3 ENSP00000359103.3 P51571

Frequencies

GnomAD3 genomes
Cov.:
26
GnomAD4 exome
Cov.:
31
GnomAD4 genome
Cov.:
26

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Benign:1
Jul 20, 2016
GeneDx
Significance: Likely benign
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1064795151; hg19: chrX-153060089; API