rs1085307174

Variant names:

• chr2-202464919-GGTAGCACCTGCTATGGCCTTT-G
• rs1085307174
• NM_001204.7:c.189_209delTAGCACCTGCTATGGCCTTTG

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PM1 PM4 PP3 PP5

The NM_001204.7(BMPR2):​c.189_209delTAGCACCTGCTATGGCCTTTG​(p.Ser64_Trp70del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: BMPR2 NM_001204.7 disruptive_inframe_deletion
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.26
• Publications: 1 publications found

Genes affected

BMPR2 (HGNC:1078): (bone morphogenetic protein receptor type 2) This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of two different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Mutations in this gene have been associated with primary pulmonary hypertension, both familial and fenfluramine-associated, and with pulmonary venoocclusive disease. [provided by RefSeq, May 2020]

BMPR2 Gene-Disease associations (from GenCC):

• pulmonary arterial hypertension

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• pulmonary hypertension, primary, 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
• heritable pulmonary arterial hypertension

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• congenital heart disease

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 1 benign, 11 uncertain in NM_001204.7
• PM4: Nonframeshift variant in NON repetitive region in NM_001204.7.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 2-202464919-GGTAGCACCTGCTATGGCCTTT-G is Pathogenic according to our data. Variant chr2-202464919-GGTAGCACCTGCTATGGCCTTT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 425715.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
BMPR2	NM_001204.7	c.189_209delTAGCACCTGCTATGGCCTTTG	p.Ser64_Trp70del	disruptive_inframe_deletion	Exon 2 of 13	ENST00000374580.10	NP_001195.2
BMPR2	XM_011511687.2	c.189_209delTAGCACCTGCTATGGCCTTTG	p.Ser64_Trp70del	disruptive_inframe_deletion	Exon 2 of 13		XP_011509989.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
BMPR2	ENST00000374580.10	c.189_209delTAGCACCTGCTATGGCCTTTG	p.Ser64_Trp70del	disruptive_inframe_deletion	Exon 2 of 13	1	NM_001204.7	ENSP00000363708.4
BMPR2	ENST00000374574.2	c.189_209delTAGCACCTGCTATGGCCTTTG	p.Ser64_Trp70del	disruptive_inframe_deletion	Exon 2 of 12	2		ENSP00000363702.2
BMPR2	ENST00000479069.1	n.96_116delTAGCACCTGCTATGGCCTTTG		non_coding_transcript_exon_variant	Exon 1 of 3	3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Pulmonary hypertension, primary, 1 Pathogenic:1

-

Rare Disease Genomics Group, St George's University of London

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1085307174; hg19: chr2-203329642;