rs113994204

Variant names:

• chr17-3648903-ATATTACTATCCTTGAGCTCCC-A
• rs113994204
• NM_004937.3:c.198_218delTATTACTATCCTTGAGCTCCC

Variant summary

Our verdict is Pathogenic. The variant received 14 ACMG points: 14P and 0B. PS3 PM4 PP5_Very_Strong

The NM_004937.3(CTNS):​c.198_218delTATTACTATCCTTGAGCTCCC​(p.Ile67_Pro73del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000254 in 1,613,814 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV002215691: Experimental studies have shown that this variant affects CTNS function (PMID:15128704).". Synonymous variant affecting the same amino acid position (i.e. N66N) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000026 (0 hom.)
• Consequence: CTNS NM_004937.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7 O:1
• Conservation: PhyloP100: 5.93
• Publications: 7 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS Gene-Disease associations (from GenCC):

• cystinosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Myriad Women’s Health
• nephropathic cystinosis

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp, Ambry Genetics
• juvenile nephropathic cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Orphanet, Labcorp Genetics (formerly Invitae)
• ocular cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• nephropathic infantile cystinosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

LOC105371493 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 14 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV002215691: Experimental studies have shown that this variant affects CTNS function (PMID: 15128704).
• PM4: Nonframeshift variant in NON repetitive region in NM_004937.3.
• PP5: Variant 17-3648903-ATATTACTATCCTTGAGCTCCC-A is Pathogenic according to our data. Variant chr17-3648903-ATATTACTATCCTTGAGCTCCC-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 21438.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_004937.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	NM_004937.3	MANE Select	c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 12	NP_004928.2	O60931-1
	CTNS	NM_001031681.3		c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 13	NP_001026851.2	O60931-2
	CTNS	NM_001374492.1		c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 13	NP_001361421.1	O60931-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNS	ENST00000046640.9	TSL:1 MANE Select	c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 12	ENSP00000046640.4	O60931-1
	CTNS	ENST00000381870.8	TSL:1	c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 13	ENSP00000371294.3	O60931-2
	CTNS	ENST00000673965.1		c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 12	ENSP00000500995.1	O60931-1

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152214 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000199 AC: 5 AN: 251472 AF XY: 0.0000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000578

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000264

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000260 AC: 38 AN: 1461600 Hom.: 0 AF XY: 0.0000220 AC XY: 16 AN XY: 727142

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53400

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000315 AC: 35 AN: 1111758

Other (OTH) AF: 0.0000166 AC: 1 AN: 60386

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152214 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74370

African (AFR) AF: 0.00 AC: 0 AN: 41446

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5204

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000712 Hom.: 0

Bravo AF: 0.00000378

ClinVar

ClinVar submissions

Significance: Pathogenic/Likely pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
3	-	-	Nephropathic cystinosis (4)
2	-	-	Cystinosis (2)
1	-	-	Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis (1)
1	-	-	Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994204; hg19: chr17-3552197;