rs113994204

Variant names:

• chr17-3648903-ATATTACTATCCTTGAGCTCCC-A
• rs113994204
• NM_004937.3:c.198_218delTATTACTATCCTTGAGCTCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PM4 PP5_Very_Strong

The NM_004937.3(CTNS):​c.198_218delTATTACTATCCTTGAGCTCCC​(p.Ile67_Pro73del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000254 in 1,613,814 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. N66N) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000026 (0 hom.)
• Consequence: CTNS NM_004937.3 disruptive_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:7 O:1
• Conservation: PhyloP100: 5.93
• Publications: 7 publications found

Genes affected

CTNS (HGNC:2518): (cystinosin, lysosomal cystine transporter) This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]

CTNS Gene-Disease associations (from GenCC):

• cystinosis

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• nephropathic cystinosis

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp, G2P
• juvenile nephropathic cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
• ocular cystinosis

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp
• nephropathic infantile cystinosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

LOC105371493 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_004937.3.
• PP5: Variant 17-3648903-ATATTACTATCCTTGAGCTCCC-A is Pathogenic according to our data. Variant chr17-3648903-ATATTACTATCCTTGAGCTCCC-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 21438.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CTNS	NM_004937.3	c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 12	ENST00000046640.9	NP_004928.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTNS	ENST00000046640.9	c.198_218delTATTACTATCCTTGAGCTCCC	p.Ile67_Pro73del	disruptive_inframe_deletion	Exon 5 of 12	1	NM_004937.3	ENSP00000046640.4

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152214 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000441

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000199 AC: 5 AN: 251472 AF XY: 0.0000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000578

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000264

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000260 AC: 38 AN: 1461600 Hom.: 0 AF XY: 0.0000220 AC XY: 16 AN XY: 727142

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33478

American (AMR) AF: 0.0000447 AC: 2 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39698

South Asian (SAS) AF: 0.00 AC: 0 AN: 86252

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53400

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.0000315 AC: 35 AN: 1111758

Other (OTH) AF: 0.0000166 AC: 1 AN: 60386

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152214 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74370

African (AFR) AF: 0.00 AC: 0 AN: 41446

American (AMR) AF: 0.00 AC: 0 AN: 15280

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3470

East Asian (EAS) AF: 0.00 AC: 0 AN: 5204

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10622

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000441 AC: 3 AN: 68040

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.0000712 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:7 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Nephropathic cystinosis Pathogenic:3 Other:1

Nov 22, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

May 28, 2019

Mendelics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Dec 27, 2019

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

NM_001031681.2(CTNS):c.198_218del21(aka I67_P73del) is classified as likely pathogenic in the context of cystinosis and is associated with a less severe form of disease. Sources cited for classification include the following: PMID 18178779‚Äé, 9792862, 21305353 and 15128704. Classification of NM_001031681.2(CTNS):c.198_218del21(aka I67_P73del) is based on the following criteria: There is strong evidence of association with the variant and the relevant disease. Please note: this variant was assessed in the context of healthy population screening. -

Cystinosis Pathogenic:2

Apr 09, 2018

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: CTNS c.198_218del21 (p.Ile67_Pro73del) results in an in-frame deletion that is predicted to remove ITILELP amino acids from the encoded protein. c.198_218del21 has been reported in the literature in multiple individuals affected with Cystinosis as both a homozygous and compound heterozygous allele. These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as pathogenic. -

Feb 11, 2021

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Juvenile nephropathic cystinosis;C2931013:Ocular cystinosis;C2931187:Nephropathic cystinosis Pathogenic:1

Aug 16, 2021

Fulgent Genetics, Fulgent Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Juvenile nephropathic cystinosis;C0950123:Inborn genetic diseases;C2931013:Ocular cystinosis Pathogenic:1

Sep 08, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.198_218del, results in the deletion of 7 amino acid(s) of the CTNS protein (p.Ile67_Pro73del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs113994204, gnomAD 0.006%). This variant has been observed in individual(s) with cystinosis (PMID: 9792862, 28629674). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 21438). Algorithms developed to predict the effect of variants on gene product structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects CTNS function (PMID: 15128704). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.9
Mutation Taster		=5/195	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113994204; hg19: chr17-3552197;