rs11498192

Variant names:

• chr6-45422749-AGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGC-A
• rs11498192
• NM_001024630.4:c.225_260delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC

Your query was ambiguous. Multiple possible variants found:

• chr6-45422749-AGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGC-A
• chr6-45422749-AGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGC-AGGCGGCGGCGGCGGCTGC
• chr6-45422749-AGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGC-AGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGCGGCGGCTGC

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001024630.4(RUNX2):​c.225_260delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC​(p.Ala76_Ala87del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.00000362 in 1,379,934 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. A75A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 29)
  • Exomes 𝑓: 0.0000036 (1 hom.)
• Consequence: RUNX2 NM_001024630.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 4.35
• Publications: 6 publications found

Genes affected

RUNX2 (HGNC:10472): (RUNX family transcription factor 2) This gene is a member of the RUNX family of transcription factors and encodes a nuclear protein with an Runt DNA-binding domain. This protein is essential for osteoblastic differentiation and skeletal morphogenesis and acts as a scaffold for nucleic acids and regulatory factors involved in skeletal gene expression. The protein can bind DNA both as a monomer or, with more affinity, as a subunit of a heterodimeric complex. Two regions of potential trinucleotide repeat expansions are present in the N-terminal region of the encoded protein, and these and other mutations in this gene have been associated with the bone development disorder cleidocranial dysplasia (CCD). Transcript variants that encode different protein isoforms result from the use of alternate promoters as well as alternate splicing. [provided by RefSeq, Jul 2016]

RUNX2 Gene-Disease associations (from GenCC):

• cleidocranial dysplasia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P, PanelApp Australia, Orphanet
• metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome

  Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001024630.4
• BS2: High AC in GnomAdExome4 at 5 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001024630.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	NM_001024630.4	MANE Select	c.225_260delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala76_Ala87del	disruptive_inframe_deletion	Exon 3 of 9	NP_001019801.3	Q13950-1
	RUNX2	NM_001369405.1		c.183_218delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala62_Ala73del	disruptive_inframe_deletion	Exon 1 of 7	NP_001356334.1	Q13950-2
	RUNX2	NM_001015051.4		c.225_260delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala76_Ala87del	disruptive_inframe_deletion	Exon 3 of 8	NP_001015051.3	Q13950-3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	RUNX2	ENST00000647337.2	MANE Select	c.225_260delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala76_Ala87del	disruptive_inframe_deletion	Exon 3 of 9	ENSP00000495497.1	Q13950-1
	RUNX2	ENST00000359524.7	TSL:1	c.183_218delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala62_Ala73del	disruptive_inframe_deletion	Exon 1 of 7	ENSP00000352514.5	Q13950-2
	RUNX2	ENST00000625924.1	TSL:1	c.183_218delGGCGGCTGCGGCGGCGGCGGCGGCTGCGGCGGCGGC	p.Ala62_Ala73del	disruptive_inframe_deletion	Exon 1 of 6	ENSP00000485863.1	A0A0D9SEN7

Frequencies

GnomAD3 genomes Cov.: 29

GnomAD2 exomes AF: 0.0000246 AC: 4 AN: 162630 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000115

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000134

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000362 AC: 5 AN: 1379934 Hom.: 1 AF XY: 0.00 AC XY: 0 AN XY: 685076

African (AFR) AF: 0.00 AC: 0 AN: 28596

American (AMR) AF: 0.00 AC: 0 AN: 32990

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 23584

East Asian (EAS) AF: 0.0000615 AC: 2 AN: 32500

South Asian (SAS) AF: 0.0000133 AC: 1 AN: 75430

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 49430

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5326

European-Non Finnish (NFE) AF: 9.30e-7 AC: 1 AN: 1075584

Other (OTH) AF: 0.0000177 AC: 1 AN: 56494

GnomAD4 genome Cov.: 29

Alfa AF: 0.00 Hom.: 134

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.3
Mutation Taster		=192/8	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs11498192; hg19: chr6-45390486;