rs1275194263

Variant names:

• chrX-102715124-ACCCAAAACGGAGGCTCAAGGAATCACAGGGGCCAGG-A
• rs1275194263
• NM_001004051.4:c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_001004051.4(GPRASP2):​c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC​(p.Glu89_Thr100del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000248 in 1,211,530 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars). Synonymous variant affecting the same amino acid position (i.e. T88T) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000018 (0 hom., 0 hem., cov: 24)
  • Exomes 𝑓: 9.1e-7 (0 hom. 0 hem.)
• Consequence: GPRASP2 NM_001004051.4 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance no assertion criteria provided U:1
• Conservation: PhyloP100: 2.84
• Publications: 0 publications found

Genes affected

GPRASP2 (HGNC:25169): (G protein-coupled receptor associated sorting protein 2) The protein encoded by this gene is a member of a family that regulates the activity of G protein-coupled receptors (GPCRs). The encoded protein has been shown to be capable of interacting with several GPCRs, including the M1 muscarinic acetylcholine receptor and the calcitonin receptor. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]

ARMCX5-GPRASP2 (HGNC:42000): (ARMCX5-GPRASP2 readthrough) This locus represents naturally occurring readthrough transcription among the adjacent armadillo repeat containing, X-linked 5 (ARMCX5), G protein-coupled receptor associated sorting proteins 1 and 2 (GPRASP1 and GPRASP2), basic helix-loop-helix family member b9 (BHLHB9), and long intergenic non-protein coding RNA 630 (LINC00630) genes on chromosome X. Transcripts may make use of multiple alternative promoters and polyadenylation signals in this region. Readthrough transcripts may produce proteins identical to the proteins encoded by GPRASP2 or BHLHB9. [provided by RefSeq, Apr 2017]

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001004051.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001004051.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPRASP2	NM_001004051.4	MANE Select	c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC	p.Glu89_Thr100del	disruptive_inframe_deletion	Exon 5 of 5	NP_001004051.1	Q96D09
	GPRASP2	NM_001184874.3		c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC	p.Glu89_Thr100del	disruptive_inframe_deletion	Exon 5 of 5	NP_001171803.1	Q96D09
	GPRASP2	NM_001184875.3		c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC	p.Glu89_Thr100del	disruptive_inframe_deletion	Exon 4 of 4	NP_001171804.1	Q96D09

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GPRASP2	ENST00000483720.7	TSL:2 MANE Select	c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC	p.Glu89_Thr100del	disruptive_inframe_deletion	Exon 5 of 5	ENSP00000507692.1	Q96D09
	GPRASP2	ENST00000332262.10	TSL:1	c.264_299delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC	p.Glu89_Thr100del	disruptive_inframe_deletion	Exon 4 of 4	ENSP00000339057.3	Q96D09
	ARMCX5-GPRASP2	ENST00000652409.1		c.-756+867_-756+902delGGAGGCTCAAGGAATCACAGGGGCCAGGCCCAAAAC		intron	N/A	ENSP00000498643.1

Frequencies

GnomAD3 genomes AF: 0.0000176 AC: 2 AN: 113372 Hom.: 0 Cov.: 24

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000184

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000547 AC: 1 AN: 182878 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000365

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 9.11e-7 AC: 1 AN: 1098158 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 363550

African (AFR) AF: 0.00 AC: 0 AN: 26403

American (AMR) AF: 0.0000284 AC: 1 AN: 35205

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 19385

East Asian (EAS) AF: 0.00 AC: 0 AN: 30206

South Asian (SAS) AF: 0.00 AC: 0 AN: 54146

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 40503

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4137

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 842086

Other (OTH) AF: 0.00 AC: 0 AN: 46087

GnomAD4 genome AF: 0.0000176 AC: 2 AN: 113372 Hom.: 0 Cov.: 24 AF XY: 0.00 AC XY: 0 AN XY: 35518

African (AFR) AF: 0.00 AC: 0 AN: 31251

American (AMR) AF: 0.000184 AC: 2 AN: 10868

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2658

East Asian (EAS) AF: 0.00 AC: 0 AN: 3594

South Asian (SAS) AF: 0.00 AC: 0 AN: 2803

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6315

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 239

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 53416

Other (OTH) AF: 0.00 AC: 0 AN: 1537

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000113

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	1	-	GPRASP2-related disorder (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.8

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1275194263; hg19: chrX-101970052;