rs1297931953
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_020184.4(CNNM4):c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC(p.Pro10_Arg18del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000169 in 1,185,504 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_020184.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Jalili syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020184.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CNNM4 | TSL:1 MANE Select | c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Pro10_Arg18del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000366275.2 | Q6P4Q7-1 | ||
| CNNM4 | c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Pro10_Arg18del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000600341.1 | ||||
| CNNM4 | c.29_55delCGGTCGGCGGACCGGCCCGCGGGCGCC | p.Pro10_Arg18del | disruptive_inframe_deletion | Exon 1 of 8 | ENSP00000636824.1 |
Frequencies
GnomAD3 genomes AF: 0.0000335 AC: 5AN: 149148Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.00 AC: 0AN: 3278 AF XY: 0.00
GnomAD4 exome AF: 0.0000145 AC: 15AN: 1036248Hom.: 0 AF XY: 0.0000102 AC XY: 5AN XY: 488502 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000335 AC: 5AN: 149256Hom.: 0 Cov.: 31 AF XY: 0.0000275 AC XY: 2AN XY: 72816 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at