rs1327920237
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The ENST00000673673.2(MLH1):c.-301_-281delCCGAGCTCCTAAAAACGAACC variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000117 in 858,126 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
ENST00000673673.2 5_prime_UTR
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: ENST00000673673.2. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MLH1 | c.-301_-281delCCGAGCTCCTAAAAACGAACC | 5_prime_UTR | Exon 1 of 18 | ENSP00000500979.2 | A0A669KAW3 | ||||
| EPM2AIP1 | TSL:6 MANE Select | c.-188_-168delTTCGTTTTTAGGAGCTCGGGG | upstream_gene | N/A | ENSP00000406027.1 | Q7L775 | |||
| MLH1 | TSL:1 | c.-303_-283delCCCCGAGCTCCTAAAAACGAA | upstream_gene | N/A | ENSP00000416476.2 | H0Y806 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152220Hom.: 0 Cov.: 33 show subpopulations
GnomAD4 exome AF: 0.0000127 AC: 9AN: 705906Hom.: 0 AF XY: 0.0000138 AC XY: 5AN XY: 362138 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152220Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74356 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at