rs137854373

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4PP3

The NM_000548.5(TSC2):​c.1737_1814delTGCAAGCCACGCCACGCGTGTGTATGAGATGCTGGTCAGCCACATTCAGCTCCACTACAAGCACAGCTACACCCTGCC​(p.Ala580_Pro605del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

TSC2
NM_000548.5 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 7.95

Publications

1 publications found
Variant links:
Genes affected
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
TSC2 Gene-Disease associations (from GenCC):
  • tuberous sclerosis
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • tuberous sclerosis 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
  • lymphangioleiomyomatosis
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • tuberous sclerosis complex
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_000548.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC2NM_000548.5 linkc.1737_1814delTGCAAGCCACGCCACGCGTGTGTATGAGATGCTGGTCAGCCACATTCAGCTCCACTACAAGCACAGCTACACCCTGCC p.Ala580_Pro605del disruptive_inframe_deletion Exon 17 of 42 ENST00000219476.9 NP_000539.2 P49815-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC2ENST00000219476.9 linkc.1737_1814delTGCAAGCCACGCCACGCGTGTGTATGAGATGCTGGTCAGCCACATTCAGCTCCACTACAAGCACAGCTACACCCTGCC p.Ala580_Pro605del disruptive_inframe_deletion Exon 17 of 42 5 NM_000548.5 ENSP00000219476.3 P49815-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Tuberous sclerosis syndrome Other:1
-
Tuberous sclerosis database (TSC2)
Significance:not provided
Review Status:no classification provided
Collection Method:curation

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.0
Mutation Taster
=0/200
disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs137854373; hg19: chr16-2120465; API