rs137854420
Variant summary
Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2
The NM_000548.5(TSC2):c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG(p.Pro1784AlafsTer91) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).
Frequency
Genomes: not found (cov: 33)
Consequence
TSC2
NM_000548.5 frameshift
NM_000548.5 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 4.46
Genes affected
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 6 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 7 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
TSC2 | NM_000548.5 | c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG | p.Pro1784AlafsTer91 | frameshift_variant | Exon 42 of 42 | ENST00000219476.9 | NP_000539.2 | |
PKD1 | NM_001009944.3 | c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA | downstream_gene_variant | ENST00000262304.9 | NP_001009944.3 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
TSC2 | ENST00000219476.9 | c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG | p.Pro1784AlafsTer91 | frameshift_variant | Exon 42 of 42 | 5 | NM_000548.5 | ENSP00000219476.3 | ||
PKD1 | ENST00000262304.9 | c.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA | downstream_gene_variant | 1 | NM_001009944.3 | ENSP00000262304.4 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 33
GnomAD4 genome
Cov.:
33
ClinVar
Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link
Submissions by phenotype
Tuberous sclerosis syndrome Other:1
-
Tuberous sclerosis database (TSC2)
Significance: not provided
Review Status: no classification provided
Collection Method: curation
- -
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at