rs137854420

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_StrongPM2

The NM_000548.5(TSC2):​c.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG​(p.Pro1784AlafsTer91) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

TSC2
NM_000548.5 frameshift

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 4.46
Variant links:
Genes affected
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 7 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
TSC2NM_000548.5 linkc.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG p.Pro1784AlafsTer91 frameshift_variant Exon 42 of 42 ENST00000219476.9 NP_000539.2 P49815-1
PKD1NM_001009944.3 linkc.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA downstream_gene_variant ENST00000262304.9 NP_001009944.3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
TSC2ENST00000219476.9 linkc.5340_5371delTCCAGCCGAGCCCACACCTGGCTATGAGGTGG p.Pro1784AlafsTer91 frameshift_variant Exon 42 of 42 5 NM_000548.5 ENSP00000219476.3 P49815-1
PKD1ENST00000262304.9 linkc.*1170_*1201delCCACCTCATAGCCAGGTGTGGGCTCGGCTGGA downstream_gene_variant 1 NM_001009944.3 ENSP00000262304.4 P98161-1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Tuberous sclerosis syndrome Other:1
-
Tuberous sclerosis database (TSC2)
Significance: not provided
Review Status: no classification provided
Collection Method: curation

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs137854420; hg19: chr16-2138526; API