rs1470521514
Variant summary
Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3BS2
The NM_139058.3(ARX):c.321_341delGGCGGCGGCGGCGGCAGCGGC(p.Ala108_Ala114del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000914 in 766,243 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 3 hemizygotes in GnomAD. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_139058.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -5 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000937 AC: 1AN: 106683Hom.: 0 Cov.: 22 AF XY: 0.0000315 AC XY: 1AN XY: 31719
GnomAD4 exome AF: 0.00000910 AC: 6AN: 659560Hom.: 0 AF XY: 0.00000997 AC XY: 2AN XY: 200642
GnomAD4 genome AF: 0.00000937 AC: 1AN: 106683Hom.: 0 Cov.: 22 AF XY: 0.0000315 AC XY: 1AN XY: 31719
ClinVar
Submissions by phenotype
Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Uncertain:1
This variant, c.321_341del, results in the deletion of 7 amino acid(s) of the ARX protein (p.Ala109_Ala115del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with ARX-related conditions. ClinVar contains an entry for this variant (Variation ID: 540220). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at