rs150506480

Variant names:

• chr1-92483343-AGCCCCGCCTGGCCCGCGCGC-A
• rs150506480
• NM_005263.5:c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC

Your query was ambiguous. Multiple possible variants found:

• chr1-92483343-AGCCCCGCCTGGCCCGCGCGC-A
• chr1-92483343-AGCCCCGCCTGGCCCGCGCGC-AGCCCCGCCTGGCCCGCGCGCGCCCCGCCTGGCCCGCGCGC

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BA1

The NM_005263.5(GFI1):​c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.012 in 1,285,568 control chromosomes in the GnomAD database, including 271 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.026 (130 hom., cov: 32)
  • Exomes 𝑓: 0.010 (141 hom.)
• Consequence: GFI1 NM_005263.5 intron
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 1.82
• Publications: 0 publications found

Genes affected

GFI1 (HGNC:4237): (growth factor independent 1 transcriptional repressor) This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]

GFI1 Gene-Disease associations (from GenCC):

• neutropenia, severe congenital, 2, autosomal dominant

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• severe congenital neutropenia

  Inheritance: AD Classification: MODERATE Submitted by: Illumina
• autosomal dominant severe congenital neutropenia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant 1-92483343-AGCCCCGCCTGGCCCGCGCGC-A is Benign according to our data. Variant chr1-92483343-AGCCCCGCCTGGCCCGCGCGC-A is described in ClinVar as Benign. ClinVar VariationId is 259700.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.0717 is higher than 0.05.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005263.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GFI1	NM_005263.5	MANE Select	c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	NP_005254.2	Q99684
	GFI1	NM_001127215.3		c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	NP_001120687.1	Q99684
	GFI1	NM_001127216.3		c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	NP_001120688.1	Q99684

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	GFI1	ENST00000294702.6	TSL:2 MANE Select	c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	ENSP00000294702.5	Q99684
	GFI1	ENST00000370332.5	TSL:1	c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	ENSP00000359357.1	Q99684
	GFI1	ENST00000427103.6	TSL:1	c.115+10_115+29delGCGCGCGGGCCAGGCGGGGC		intron	N/A	ENSP00000399719.1	Q99684

Frequencies

GnomAD3 genomes AF: 0.0259 AC: 3934 AN: 152110 Hom.: 130 Cov.: 32

Gnomad AFR AF: 0.0740

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0218

Gnomad ASJ AF: 0.0138

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00104

Gnomad FIN AF: 0.000283

Gnomad MID AF: 0.0411

Gnomad NFE AF: 0.00581

Gnomad OTH AF: 0.0344

GnomAD2 exomes AF: 0.0113 AC: 2575 AN: 227540 AF XY: 0.00965

Gnomad AFR exome AF: 0.0826

Gnomad AMR exome AF: 0.0131

Gnomad ASJ exome AF: 0.0158

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.000479

Gnomad NFE exome AF: 0.00735

Gnomad OTH exome AF: 0.0135

GnomAD4 exome AF: 0.0101 AC: 11446 AN: 1133340 Hom.: 141 AF XY: 0.00956 AC XY: 5527 AN XY: 577904

African (AFR) AF: 0.0864 AC: 2393 AN: 27712

American (AMR) AF: 0.0146 AC: 632 AN: 43150

Ashkenazi Jewish (ASJ) AF: 0.0150 AC: 359 AN: 23890

East Asian (EAS) AF: 0.0000266 AC: 1 AN: 37642

South Asian (SAS) AF: 0.000421 AC: 33 AN: 78370

European-Finnish (FIN) AF: 0.00103 AC: 53 AN: 51444

Middle Eastern (MID) AF: 0.0165 AC: 74 AN: 4490

European-Non Finnish (NFE) AF: 0.00885 AC: 7228 AN: 817114

Other (OTH) AF: 0.0136 AC: 673 AN: 49528

GnomAD4 genome AF: 0.0259 AC: 3937 AN: 152228 Hom.: 130 Cov.: 32 AF XY: 0.0246 AC XY: 1831 AN XY: 74448

African (AFR) AF: 0.0739 AC: 3069 AN: 41546

American (AMR) AF: 0.0217 AC: 332 AN: 15300

Ashkenazi Jewish (ASJ) AF: 0.0138 AC: 48 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5160

South Asian (SAS) AF: 0.00104 AC: 5 AN: 4824

European-Finnish (FIN) AF: 0.000283 AC: 3 AN: 10618

Middle Eastern (MID) AF: 0.0442 AC: 13 AN: 294

European-Non Finnish (NFE) AF: 0.00581 AC: 395 AN: 67990

Other (OTH) AF: 0.0340 AC: 72 AN: 2116

Alfa AF: 0.0149 Hom.: 12

Bravo AF: 0.0307

Asia WGS AF: 0.00491 AC: 17 AN: 3478

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	Neutropenia, severe congenital, 2, autosomal dominant (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.8
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs150506480; hg19: chr1-92948900;