rs1553126848

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_001048174.2(MUTYH):​c.940_962delTGCCTGCCTCCCTCGGAGCCCTG​(p.Cys314fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 33)

Consequence

MUTYH
NM_001048174.2 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 7.53
Variant links:
Genes affected
MUTYH (HGNC:7527): (mutY DNA glycosylase) This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is Pathogenic according to our data. Variant chr1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 533319.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
MUTYHNM_001048174.2 linkuse as main transcriptc.940_962delTGCCTGCCTCCCTCGGAGCCCTG p.Cys314fs frameshift_variant 12/16 ENST00000456914.7 NP_001041639.1 Q9UIF7-6

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
MUTYHENST00000456914.7 linkuse as main transcriptc.940_962delTGCCTGCCTCCCTCGGAGCCCTG p.Cys314fs frameshift_variant 12/161 NM_001048174.2 ENSP00000407590.2 Q9UIF7-6
ENSG00000288208ENST00000671898.1 linkuse as main transcriptn.1528_1550delTGCCTGCCTCCCTCGGAGCCCTG non_coding_transcript_exon_variant 16/21 ENSP00000499896.1 A0A5F9ZGZ0

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Familial adenomatous polyposis 2 Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingLabcorp Genetics (formerly Invitae), LabcorpMay 04, 2021For these reasons, this variant has been classified as Pathogenic. Several different frameshift variants downstream of this variant (p.Pro367Glnfs*164, p.Pro405Leufs*123, and p.Ser518Alafs*54) have been determined to be likely pathogenic or pathogenic (Invitae). These truncations disrupts the conserved PCNA binding motif of MUTYH (Gln526-Phe533, also known as Gln512-Phe519 in the literature because of transcript nomenclature differences), which has been shown to be critical for MUTYH-PCNA binding (PMID: 11092888, 26377631). This suggests that disruption of this region of the MUTYH protein is causative of disease. This variant has not been reported in the literature in individuals with MUTYH-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MUTYH gene (p.Cys342Glyfs*182). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 208 amino acids of the MUTYH protein. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1553126848; hg19: chr1-45797472; API