rs1553126848

Variant names:

• chr1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C
• rs1553126848
• NM_001048174.2:c.940_962delTGCCTGCCTCCCTCGGAGCCCTG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_001048174.2(MUTYH):​c.940_962delTGCCTGCCTCCCTCGGAGCCCTG​(p.Cys314GlyfsTer182) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: MUTYH NM_001048174.2 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 7.53
• Publications: 0 publications found

Genes affected

MUTYH (HGNC:7527): (mutY DNA glycosylase) This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. This gene product is thought to play a role in signaling apoptosis by the introduction of single-strand breaks following oxidative damage. Mutations in this gene result in heritable predisposition to colorectal cancer, termed MUTYH-associated polyposis (MAP). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2017]

MUTYH Gene-Disease associations (from GenCC):

• familial adenomatous polyposis 2

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen, G2P
• colorectal cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• familial ovarian cancer

  Inheritance: AD, AR Classification: NO_KNOWN Submitted by: ClinGen
• hereditary breast carcinoma

  Inheritance: AD, AR Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000288208 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is Pathogenic according to our data. Variant chr1-45331800-CCAGGGCTCCGAGGGAGGCAGGCA-C is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 533319.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MUTYH	NM_001048174.2	c.940_962delTGCCTGCCTCCCTCGGAGCCCTG	p.Cys314GlyfsTer182	frameshift_variant	Exon 12 of 16	ENST00000456914.7	NP_001041639.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MUTYH	ENST00000456914.7	c.940_962delTGCCTGCCTCCCTCGGAGCCCTG	p.Cys314GlyfsTer182	frameshift_variant	Exon 12 of 16	1	NM_001048174.2	ENSP00000407590.2
ENSG00000288208	ENST00000671898.1	n.1528_1550delTGCCTGCCTCCCTCGGAGCCCTG		non_coding_transcript_exon_variant	Exon 16 of 21			ENSP00000499896.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial adenomatous polyposis 2 Pathogenic:2

May 04, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Several different frameshift variants downstream of this variant (p.Pro367Glnfs*164, p.Pro405Leufs*123, and p.Ser518Alafs*54) have been determined to be likely pathogenic or pathogenic (Invitae). These truncations disrupts the conserved PCNA binding motif of MUTYH (Gln526-Phe533, also known as Gln512-Phe519 in the literature because of transcript nomenclature differences), which has been shown to be critical for MUTYH-PCNA binding (PMID: 11092888, 26377631). This suggests that disruption of this region of the MUTYH protein is causative of disease. This variant has not been reported in the literature in individuals with MUTYH-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the MUTYH gene (p.Cys342Glyfs*182). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 208 amino acids of the MUTYH protein. -

Jun 30, 2025

Myriad Genetics, Inc.

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is considered likely pathogenic. This variant creates a frameshift predicted to result in premature protein truncation. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.5
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553126848; hg19: chr1-45797472;