rs1553177542

Variant names:

• chr1-1049050-TGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG-T
• rs1553177542
• NM_198576.4:c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG

Variant summary

Our verdict is Benign. Variant got -8 ACMG points: 8P and 16B. PVS1 BP6_Very_Strong BS1 BS2

The ENST00000379370.7(AGRN):​c.4290_4298+74delGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG​(p.Gln1431_Arg1433del) variant causes a splice donor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00742 in 141,150 control chromosomes in the GnomAD database, including 8 homozygotes. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0074 (8 hom., cov: 24)
  • Exomes 𝑓: 0.00075 (13 hom.)
  • Failed GnomAD Quality Control
• Consequence: AGRN ENST00000379370.7 splice_donor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 9.20

Genes affected

AGRN (HGNC:329): (agrin) This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]

ACMG classification

Verdict is Benign. Variant got -8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.
• BP6: Variant 1-1049050-TGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG-T is Benign according to our data. Variant chr1-1049050-TGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG-T is described in ClinVar as [Likely_benign]. Clinvar id is 541195.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.00742 (1047/141150) while in subpopulation AFR AF= 0.0284 (993/34928). AF 95% confidence interval is 0.027. There are 8 homozygotes in gnomad4. There are 514 alleles in male gnomad4 subpopulation. Median coverage is 24. This position pass quality control queck.
• BS2: High Homozygotes in GnomAd4 at 8 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AGRN	NM_198576.4	c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG		splice_region_variant, intron_variant	Intron 24 of 35	ENST00000379370.7	NP_940978.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AGRN	ENST00000379370.7	c.4290_4298+74delGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG	p.Gln1431_Arg1433del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 24 of 36	1	NM_198576.4	ENSP00000368678.2

Frequencies

GnomAD3 genomes AF: 0.00742 AC: 1047 AN: 141056 Hom.: 8 Cov.: 24

Gnomad AFR AF: 0.0285

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00326

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000601

Gnomad OTH AF: 0.00255

GnomAD3 exomes AF: 0.00151 AC: 233 AN: 154216 Hom.: 3 AF XY: 0.00131 AC XY: 110 AN XY: 83952

Gnomad AFR exome AF: 0.0266

Gnomad AMR exome AF: 0.000818

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000168

Gnomad SAS exome AF: 0.0000871

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000102

Gnomad OTH exome AF: 0.000923

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000752 AC: 1054 AN: 1402258 Hom.: 13 AF XY: 0.000625 AC XY: 433 AN XY: 692774

Gnomad4 AFR exome AF: 0.0270

Gnomad4 AMR exome AF: 0.00123

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000553

Gnomad4 SAS exome AF: 0.000101

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000314

Gnomad4 OTH exome AF: 0.00199

GnomAD4 genome AF: 0.00742 AC: 1047 AN: 141150 Hom.: 8 Cov.: 24 AF XY: 0.00751 AC XY: 514 AN XY: 68440

Gnomad4 AFR AF: 0.0284

Gnomad4 AMR AF: 0.00318

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000601

Gnomad4 OTH AF: 0.00253

Alfa AF: 0.000669 Hom.: 1

Asia WGS AF: 0.00173 AC: 6 AN: 3474

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:1

Oct 13, 2020

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Congenital myasthenic syndrome 8 Benign:1

Jan 29, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553177542; hg19: chr1-984430;