rs1553177542
Variant summary
Our verdict is Benign. The variant received -15 ACMG points: 1P and 16B. PP3BP6_Very_StrongBS1BS2
The NM_198576.4(AGRN):c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00742 in 141,150 control chromosomes in the GnomAD database, including 8 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).
Frequency
Consequence
NM_198576.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- congenital myasthenic syndrome 8Inheritance: AR Classification: STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- presynaptic congenital myasthenic syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- postsynaptic congenital myasthenic syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -15 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| AGRN | NM_198576.4 | c.4298+6_4298+88delCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGGGCAGCTCAGGTGGG | splice_region_variant, intron_variant | Intron 24 of 35 | ENST00000379370.7 | NP_940978.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| AGRN | ENST00000379370.7 | c.4290_4298+74delGCAGCTCAGGTGGGCGGGGAGGGGACGGGGCCGGGGCAGCTCAGGTGGGCGGGGAGGGGACGGGCGGGGGAGGGGGGGCCGGG | p.Gln1431_Arg1433del | splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant | Exon 24 of 36 | 1 | NM_198576.4 | ENSP00000368678.2 |
Frequencies
GnomAD3 genomes AF: 0.00742 AC: 1047AN: 141056Hom.: 8 Cov.: 24 show subpopulations
GnomAD2 exomes AF: 0.00151 AC: 233AN: 154216 AF XY: 0.00131 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000752 AC: 1054AN: 1402258Hom.: 13 AF XY: 0.000625 AC XY: 433AN XY: 692774 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00742 AC: 1047AN: 141150Hom.: 8 Cov.: 24 AF XY: 0.00751 AC XY: 514AN XY: 68440 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:1
Congenital myasthenic syndrome 8 Benign:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at