rs1553189986
- chr1-2229401-AGCTCAGCGAGCGCAGCGTCCGCGTGTACCACGAGTGCTTCGGCAAGTGTAAGGGGCTGCTGGTGCCCGAGCTCTACAGCAGCCCGAGCGCCGCCTGCATCCAGTGCCTGGACTGCCGCCTCATGTACCCGCCGCACAAGTTCGTGGTGCACTCGCACAAGGCCCTGGAGAACCGGACCTGCCACTGGGGCTTCGACTCGGCCAACTGGCGGGCCTACATCCTGCTGAGCCAGGATTACACGGGCAAGGAGGAGCAGGC-A
- rs1553189986
- NM_003036.4:c.638_895del
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM4PP3PP5_Moderate
The NM_003036.4(SKI):c.638_895del(p.Leu213_Ala298del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_003036.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Shprintzen-Goldberg syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, PanelApp Australia, G2P, Orphanet, Ambry Genetics, Genomics England PanelApp
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003036.4. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SKI | TSL:1 MANE Select | c.638_895del | p.Leu213_Ala298del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000367797.4 | P12755 | ||
| SKI | c.638_895del | p.Leu213_Ala298del | disruptive_inframe_deletion | Exon 1 of 7 | ENSP00000521247.1 | ||||
| SKI | n.137+1880_137+2137del | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.