rs1553277702
Variant summary
Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PVS1PS3PP5
The NM_000228.3(LAMB3):c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA(p.Asn345LysfsTer77) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000192 in 1,461,788 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). ClinVar reports functional evidence for this variant: "SCV000696002: One patient carrying this variant and another pathogenic LAMB3 variant showed absence of laminin beta3 chain. The following publication have been ascertained in the context of this evaluation (PMID:27480391).". Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000228.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- junctional epidermolysis bullosaInheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- junctional epidermolysis bullosa Herlitz typeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Ambry Genetics, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)
- junctional epidermolysis bullosa, non-Herlitz typeInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Ambry Genetics
- amelogenesis imperfecta type 1AInheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
- amelogenesis imperfecta type 1Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- generalized junctional epidermolysis bullosa non-Herlitz typeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 13 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000228.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMB3 | MANE Select | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 10 of 23 | NP_000219.2 | A0A0S2Z3R6 | ||
| LAMB3 | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 9 of 22 | NP_001017402.1 | Q13751 | |||
| LAMB3 | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 10 of 23 | NP_001121113.1 | A0A0S2Z3R6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| LAMB3 | TSL:1 MANE Select | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 10 of 23 | ENSP00000348384.3 | Q13751 | ||
| LAMB3 | TSL:1 | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 10 of 23 | ENSP00000355997.3 | Q13751 | ||
| LAMB3 | TSL:1 | c.958_1034dupGGGCACTCAGAGACATGTCACTTTGACCCCGCTGTGTTTGCCGCCAGCCAGGGGGCATATGGAGGTGTGTGTGACAA | p.Asn345LysfsTer77 | frameshift | Exon 9 of 22 | ENSP00000375778.1 | Q13751 |
Frequencies
GnomAD3 genomes AF: 0.000250 AC: 38AN: 152108Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.0000437 AC: 11AN: 251456 AF XY: 0.0000294 show subpopulations
GnomAD4 exome AF: 0.0000192 AC: 28AN: 1461788Hom.: 0 Cov.: 32 AF XY: 0.0000206 AC XY: 15AN XY: 727218 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.000269 AC: 41AN: 152226Hom.: 0 Cov.: 33 AF XY: 0.000282 AC XY: 21AN XY: 74452 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at