rs1553317813

Positions:

• chr2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PVS1_Moderate PM2 PP5_Moderate

The NM_020779.4(WDR35):​c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA​(p.Glu616_Pro617del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000706 in 1,415,718 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.1e-7 (0 hom.)
• Consequence: WDR35 NM_020779.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.73

Genes affected

WDR35 (HGNC:29250): (WD repeat domain 35) This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]

WDR35 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.02277256 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.1, offset of 39, new splice context is: gatatatttgtaattttgAGgat. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G is Pathogenic according to our data. Variant chr2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 471484.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
WDR35	NM_001006657.2	c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu627_Pro628del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	18/28	ENST00000345530.8	NP_001006658.1
WDR35	NM_020779.4	c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu616_Pro617del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	17/27	ENST00000281405.9	NP_065830.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
WDR35	ENST00000345530.8	c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu627_Pro628del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	18/28	1	NM_001006657.2	ENSP00000314444.5
WDR35	ENST00000281405.9	c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu616_Pro617del	splice_acceptor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	17/27	1	NM_020779.4	ENSP00000281405.5

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 7.06e-7 AC: 1 AN: 1415718 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 701482

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000257

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cranioectodermal dysplasia 2;C3279792:Short-rib thoracic dysplasia 7 with or without polydactyly Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Mar 19, 2017

In summary, donor and acceptor splice site variants are typically loss-of-function (PMID: 16199547), and loss-of-function variants in WDR35 are known to be pathogenic (PMID: 25908617, 21473986). However, without additional functional and/or genetic data, this variant has been classified as Likely Pathogenic. This variant has not been reported in the literature in individuals with a WDR35-related disease. This sequence change deletes 30 nucleotides from intron 17 and 3 nucleotides from exon 18 of the WDR35 mRNA (c.1879-30_1881del). It affects acceptor splice site in intron 17 and is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553317813; hg19: chr2-20141597;