rs1553317813

Variant names:

• chr2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G
• rs1553317813
• NM_001006657.2:c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PVS1_Moderate PP5_Moderate

The NM_020779.4(WDR35):​c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA​(p.Glu616_Pro617del) variant causes a splice acceptor, conservative inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000706 in 1,415,718 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.1e-7 (0 hom.)
• Consequence: WDR35 NM_020779.4 splice_acceptor, conservative_inframe_deletion, splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.73
• Publications: 0 publications found

Genes affected

WDR35 (HGNC:29250): (WD repeat domain 35) This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]

WDR35 Gene-Disease associations (from GenCC):

• cranioectodermal dysplasia 2

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, G2P, Ambry Genetics, ClinGen
• short-rib thoracic dysplasia 7 with or without polydactyly

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
• cranioectodermal dysplasia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• short rib-polydactyly syndrome, Verma-Naumoff type

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.023057217 fraction of the gene. Cryptic splice site detected, with MaxEntScore 3.1, offset of 39, new splice context is: gatatatttgtaattttgAGgat. Cryptic site results in inframe change. If cryptic site found is not functional and variant results in exon loss, it results in inframe change.
• PP5: Variant 2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G is Pathogenic according to our data. Variant chr2-19941836-GTTCCTTTAAAGACAAAAAAAAAGTTATGTTTCA-G is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 471484.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020779.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WDR35	NM_001006657.2	MANE Plus Clinical	c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu627_Pro628del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 18 of 28	NP_001006658.1	Q9P2L0-1
	WDR35	NM_020779.4	MANE Select	c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu616_Pro617del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 17 of 27	NP_065830.2	Q9P2L0-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WDR35	ENST00000345530.8	TSL:1 MANE Plus Clinical	c.1879-30_1881delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu627_Pro628del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 18 of 28	ENSP00000314444.5	Q9P2L0-1
	WDR35	ENST00000281405.9	TSL:1 MANE Select	c.1846-30_1848delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu616_Pro617del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 17 of 27	ENSP00000281405.5	Q9P2L0-2
	WDR35	ENST00000453014.1	TSL:1	c.484-30_486delTGAAACATAACTTTTTTTTTGTCTTTAAAGGAA	p.Glu162_Pro163del	splice_acceptor conservative_inframe_deletion splice_region intron	Exon 6 of 10	ENSP00000404409.1	H0Y6C0

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 7.06e-7 AC: 1 AN: 1415718 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 701482

African (AFR) AF: 0.00 AC: 0 AN: 32756

American (AMR) AF: 0.00 AC: 0 AN: 41676

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24962

East Asian (EAS) AF: 0.0000257 AC: 1 AN: 38960

South Asian (SAS) AF: 0.00 AC: 0 AN: 82524

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 50690

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5382

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1080650

Other (OTH) AF: 0.00 AC: 0 AN: 58118

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Cranioectodermal dysplasia 2;C3279792:Short-rib thoracic dysplasia 7 with or without polydactyly (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553317813; hg19: chr2-20141597;