rs1553333219

Variant names:

• chr2-47806369-A-ATTGTTTTTTTCCACAAATTCGGTTTTTT
• rs1553333219
• NM_000179.3:c.3801+12_3801+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BP6_Very_Strong

The NM_000179.3(MSH6):​c.3801+12_3801+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000547 in 1,461,818 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000055 (0 hom.)
• Consequence: MSH6 NM_000179.3 intron
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: -0.372
• Publications: 0 publications found

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 Gene-Disease associations (from GenCC):

• intellectual developmental disorder with dysmorphic facies and behavioral abnormalities

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BP6: Variant 2-47806369-A-ATTGTTTTTTTCCACAAATTCGGTTTTTT is Benign according to our data. Variant chr2-47806369-A-ATTGTTTTTTTCCACAAATTCGGTTTTTT is described in ClinVar as Likely_benign. ClinVar VariationId is 491961.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	NM_000179.3	MANE Select	c.3801+12_3801+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	NP_000170.1	P52701-1
	MSH6	NM_001406795.1		c.3897+12_3897+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	NP_001393724.1
	MSH6	NM_001406813.1		c.3807+12_3807+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	NP_001393742.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MSH6	ENST00000234420.11	TSL:1 MANE Select	c.3801+12_3801+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	ENSP00000234420.5	P52701-1
	MSH6	ENST00000445503.5	TSL:1	n.*3148+12_*3148+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	ENSP00000405294.1	F8WAX8
	MSH6	ENST00000936511.1		c.3828+12_3828+39dupTTGTTTTTTTCCACAAATTCGGTTTTTT		intron	N/A	ENSP00000606570.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251140 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000881

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000547 AC: 8 AN: 1461818 Hom.: 0 Cov.: 33 AF XY: 0.00000688 AC XY: 5 AN XY: 727206

African (AFR) AF: 0.00 AC: 0 AN: 33476

American (AMR) AF: 0.00 AC: 0 AN: 44718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39686

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53416

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1111974

Other (OTH) AF: 0.00 AC: 0 AN: 60394

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Endometrial carcinoma;C1833477:Lynch syndrome 5;C5436807:Mismatch repair cancer syndrome 3 (1)
-	-	1	Hereditary cancer-predisposing syndrome (1)
-	-	1	Hereditary nonpolyposis colorectal neoplasms (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.37

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553333219; hg19: chr2-48033508;