rs1553333718

Positions:

• chr2-47806618-T-TTGAGAAGATGAATCAGTCACTACGATTATTTCGGTAACTAACTAACTATAATGGAATTATAACTAACTGACCTTAAGTTTCAAAG

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_000179.3(MSH6):​c.3969_4001+52dupTGAGAAGATGAATCAGTCACTACGATTATTTCGGTAACTAACTAACTATAATGGAATTATAACTAACTGACCTTAAGTTTCAAAG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000192 in 1,460,330 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000033 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000019 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: MSH6 NM_000179.3 intron
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:3 B:1
• Conservation: PhyloP100: 1.45

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH6	NM_000179.3	c.3969_4001+52dupTGAGAAGATGAATCAGTCACTACGATTATTTCGGTAACTAACTAACTATAATGGAATTATAACTAACTGACCTTAAGTTTCAAAG		intron_variant		ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.3969_4001+52dupTGAGAAGATGAATCAGTCACTACGATTATTTCGGTAACTAACTAACTATAATGGAATTATAACTAACTGACCTTAAGTTTCAAAG		intron_variant		1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes AF: 0.00 AC: 5 AN: 152024 Hom.: 0 Cov.: 32 FAILED QC

Gnomad AFR AF: 0.0000242

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000588

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000192 AC: 28 AN: 1460330 Hom.: 0 Cov.: 35 AF XY: 0.0000151 AC XY: 11 AN XY: 726476

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000243

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000329 AC: 5 AN: 152024 Hom.: 0 Cov.: 32 AF XY: 0.0000404 AC XY: 3 AN XY: 74256

Gnomad4 AFR AF: 0.0000242

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000588

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:3 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1 Benign:1

Likely benign, criteria provided, single submitter	clinical testing	Ambry Genetics	Dec 18, 2020	This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -
Uncertain significance, criteria provided, single submitter	clinical testing	Color Diagnostics, LLC DBA Color Health	Feb 09, 2023	This variant creates an in-tandem duplication, encompassing the last 33 nucleotides of exon 9 and the first 52 nucleotides of intron 9 in the MSH6 gene. While this duplication does not directly disrupt the coding sequence of this gene, it creates a duplicate intron 9 splice donor site. To our knowledge, functional studies have not been reported for this variant. A similar duplication (c.3969_4001+51dup) has been reported in an individual affected with colorectal cancer whose tumor exhibited mismatch repair deficient characteristics (PMID: 14871975). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). The available evidence is insufficient to determine the role of this variant in disease conclusively. Therefore, this variant is classified as a Variant of Uncertain Significance. -

Lynch syndrome Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 25, 2015

This sequence change is a tandem duplication of 85 nucleotides in exon 9 of the MSH6 mRNA (c.3969_4001+52dup). This duplication includes the 3' end of exon 9. The impact of this duplication on both MSH6 mRNA processing and protein function is unknown. This variant is not present in population databases and has not been reported in the literature. Algorithms developed to predict the effect of nucleotide changes on mRNA splicing suggest that while this duplication is not predicted to alter the consensus splice site in intron 9, it is predicted to create 2 novel splice sites downstream of the consensus splice site that if used, will create premature translation stop codon that resulting in a truncated MSH6 protein. In the absence of transcriptional studies, it is not known if these additional site actually impact MSH6 mRNA. In summary, this is a novel variant with uncertain impact on splicing. It has been classified as a Variant of Uncertain Significance. -

Hereditary nonpolyposis colorectal neoplasms Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Aug 25, 2015

In summary, this is a novel variant with uncertain impact on splicing. It has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of nucleotide changes on mRNA splicing suggest that while this duplication is not predicted to alter the consensus splice site in intron 9, it is predicted to create 2 novel splice sites downstream of the consensus splice site that if used, will create premature translation stop codon that resulting in a truncated MSH6 protein. In the absence of transcriptional studies, it is not known if these additional site actually impact MSH6 mRNA. This variant is not present in population databases and has not been reported in the literature. This sequence change is a tandem duplication of 85 nucleotides in exon 9 of the MSH6 mRNA (c.3969_4001+52dup). This duplication includes the 3' end of exon 9. The impact of this duplication on both MSH6 mRNA processing and protein function is unknown. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553333718; hg19: chr2-48033757;