rs1553334006
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PVS1_Moderate
The NM_000179.3(MSH6):c.4022_4077dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA(p.Leu1360LysfsTer5) variant causes a frameshift, stop gained change. The variant allele was found at a frequency of 0.00000138 in 1,445,812 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L1360L) has been classified as Likely benign. The gene MSH6 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_000179.3 frameshift, stop_gained
Scores
Clinical Significance
Conservation
Publications
- intellectual developmental disorder with dysmorphic facies and behavioral abnormalitiesInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000179.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | MANE Select | c.4022_4077dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | p.Leu1360LysfsTer5 | frameshift stop_gained | Exon 10 of 10 | NP_000170.1 | P52701-1 | ||
| MSH6 | c.4118_4173dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | p.Leu1392LysfsTer5 | frameshift stop_gained | Exon 11 of 11 | NP_001393724.1 | ||||
| MSH6 | c.4028_4083dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | p.Leu1362LysfsTer5 | frameshift stop_gained | Exon 10 of 10 | NP_001393742.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MSH6 | TSL:1 MANE Select | c.4022_4077dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | p.Leu1360LysfsTer5 | frameshift stop_gained | Exon 10 of 10 | ENSP00000234420.5 | P52701-1 | ||
| MSH6 | TSL:1 | n.*3369_*3424dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | non_coding_transcript_exon | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 | |||
| MSH6 | TSL:1 | n.*3369_*3424dupAAAGGTCAACTGTAGATGCTGAAGCTGTCCATAAATTGCTGACTTTGATTAAGGAA | 3_prime_UTR | Exon 9 of 9 | ENSP00000405294.1 | F8WAX8 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD2 exomes AF: 0.00000401 AC: 1AN: 249448 AF XY: 0.00000742 show subpopulations
GnomAD4 exome AF: 0.00000138 AC: 2AN: 1445812Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 719626 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.