rs1553334099

Positions:

• chr2-47806845-GATTAAGGAATTATAGACTGACTAC-G

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_000179.3(MSH6):​c.4072_*12delAAGGAATTATAGACTGACTACATT​(p.Lys1358_Ter1361del) variant causes a stop lost, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MSH6 NM_000179.3 stop_lost, conservative_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.75

Genes affected

MSH6 (HGNC:7329): (mutS homolog 6) This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]

FBXO11 (HGNC:13590): (F-box protein 11) This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]

FBXO11 (HGNC:):

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_000179.3 Downstream stopcodon found after 1389 codons.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
MSH6	NM_000179.3	c.4072_*12delAAGGAATTATAGACTGACTACATT	p.Lys1358_Ter1361del	stop_lost, conservative_inframe_deletion	10/10	ENST00000234420.11	NP_000170.1
MSH6	NM_000179.3	c.4072_*12delAAGGAATTATAGACTGACTACATT		3_prime_UTR_variant	10/10	ENST00000234420.11	NP_000170.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
MSH6	ENST00000234420.11	c.4072_*12delAAGGAATTATAGACTGACTACATT	p.Lys1358_Ter1361del	stop_lost, conservative_inframe_deletion	10/10	1	NM_000179.3	ENSP00000234420.5
MSH6	ENST00000234420.11	c.4072_*12delAAGGAATTATAGACTGACTACATT		3_prime_UTR_variant	10/10	1	NM_000179.3	ENSP00000234420.5

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary nonpolyposis colorectal neoplasms Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Feb 18, 2022

This sequence change results in a frameshift in the MSH6 gene (p.Lys1358_Leu1360delinsGlySerPheext*21). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 3 amino acid(s) of the MSH6 protein and extend the protein by 21 additional amino acid residues. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with MSH6-related conditions. ClinVar contains an entry for this variant (Variation ID: 455320). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553334099; hg19: chr2-48033984;