rs1553354646

Variant names:

• chr2-51699459-CAATGCCCCACTTAATGCAGGTTGAGAAATAAGTGAAACTATGACATGGAAAAATATTACAATAAGCGAAAAATATTACAATAAAGGAAAAAATAATGGAAGAATATCAGTATTTGATGCTATTATACGTGACCATATTGTTTAGCAAACTACTTCAAAAATGAAATTAGGAATTTCAGAGAATCATTTTATTCTCATATCAGAATGCTTGGAAAAGTGAGGGCTAAATGTATTTGTTATTTGACTGTGTACATTATGCCCATGGAATAGCATTTTGGAAGACCCAACATTAAGCTAGCTTTACATA-C
• rs1553354646
• ENST00000440698.1:n.754-62629_754-62324del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000440698.1(NRXN1-DT):​n.754-62629_754-62324del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 30)
• Consequence: NRXN1-DT ENST00000440698.1 intron
• Clinical Significance: not provided no classification provided O:4
• Conservation: PhyloP100: 0.731
• Publications: 0 publications found

Genes affected

NRXN1-DT (HGNC:52686): (NRXN1 divergent transcript)

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000440698.1. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NRXN1-DT	NR_135237.1		n.754-62628_754-62323del		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NRXN1-DT	ENST00000440698.1	TSL:2	n.754-62629_754-62324del		intron	N/A
	NRXN1-DT	ENST00000843923.1		n.45+13006_45+13311del		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 30

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 30

ClinVar

ClinVar submissions

Significance: not provided

Revision: no classification provided

Pathogenic	VUS	Benign	Condition
-	-	-	Gestational diabetes mellitus uncontrolled (1)
-	-	-	Large for gestational age (1)
-	-	-	Normal pregnancy (1)
-	-	-	Preeclampsia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.73

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553354646; hg19: chr2-51926597;