rs1553619923

Variant names:

• chr3-10146488-T-TTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA
• rs1553619923
• NM_000551.4:c.341-25_370dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_000551.4(VHL):​c.341-25_370dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA​(p.Thr124fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000657 in 152,152 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.0000034 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: VHL NM_000551.4 frameshift
• Clinical Significance: Uncertain significance reviewed by expert panel P:1 U:3
• Conservation: PhyloP100: 1.44
• Publications: 0 publications found

Genes affected

VHL (HGNC:12687): (von Hippel-Lindau tumor suppressor) This gene encodes a component of a ubiquitination complex. The encoded protein is involved in the ubiquitination and degradation of hypoxia-inducible-factor (HIF), which is a transcription factor that plays a central role in the regulation of gene expression by oxygen. In addition to oxygen-related gene expression, this protein plays a role in many other cellular processes including cilia formation, cytokine signaling, regulation of senescence, and formation of the extracellular matrix. Variants of this gene are associated with von Hippel-Lindau syndrome, pheochromocytoma, erythrocytosis, renal cell carcinoma, and cerebellar hemangioblastoma. [provided by RefSeq, Jun 2022]

VHL Gene-Disease associations (from GenCC):

• pheochromocytoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P
• von Hippel-Lindau disease

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, ClinGen, Genomics England PanelApp, G2P
• renal cell carcinoma

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• autosomal recessive secondary polycythemia not associated with VHL gene

  Inheritance: AR Classification: STRONG Submitted by: Ambry Genetics
• Chuvash polycythemia

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet
• hereditary pheochromocytoma-paraganglioma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000551.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	NM_000551.4	MANE Select	c.341-25_370dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA	p.Thr124fs	frameshift	Exon 2 of 3	NP_000542.1	A0A024R2F2
	VHL	NM_001354723.2		c.*18-3298_*18-3244dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA		intron	N/A	NP_001341652.1	A0A8Q3WL21
	VHL	NM_198156.3		c.341-3298_341-3244dupTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA		intron	N/A	NP_937799.1	A0A0S2Z4K1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	VHL	ENST00000256474.3	TSL:1 MANE Select	c.341-26_341-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA		intron	N/A	ENSP00000256474.3	P40337-1
	VHL	ENST00000345392.3	TSL:1	c.341-3299_341-3298insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA		intron	N/A	ENSP00000344757.2	P40337-2
	VHL	ENST00000477538.2	TSL:1	n.1221-26_1221-25insTAACAACCTTTGCTTGTCCCGATAGGTCACCTTTGGCTCTTCAGAGATGCAGGGA		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152152 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251484 AF XY: 0.00000736

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00000879

Gnomad OTH exome AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000342 AC: 5 AN: 1460500 Hom.: 0 Cov.: 31 AF XY: 0.00000413 AC XY: 3 AN XY: 726554

African (AFR) AF: 0.00 AC: 0 AN: 33444

American (AMR) AF: 0.00 AC: 0 AN: 44694

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26074

East Asian (EAS) AF: 0.00 AC: 0 AN: 39648

South Asian (SAS) AF: 0.00 AC: 0 AN: 86238

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53312

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5760

European-Non Finnish (NFE) AF: 0.00000450 AC: 5 AN: 1111040

Other (OTH) AF: 0.00 AC: 0 AN: 60290

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152152 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74306

African (AFR) AF: 0.00 AC: 0 AN: 41438

American (AMR) AF: 0.00 AC: 0 AN: 15248

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5198

South Asian (SAS) AF: 0.00 AC: 0 AN: 4828

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68034

Other (OTH) AF: 0.00 AC: 0 AN: 2092

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: reviewed by expert panel

Pathogenic	VUS	Benign	Condition
1	1	-	Von Hippel-Lindau syndrome (2)
-	1	-	Hereditary cancer-predisposing syndrome (1)
-	1	-	Von Hippel-Lindau syndrome;C1837915:Chuvash polycythemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.4
Mutation Taster		=100/0	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553619923; hg19: chr3-10188172;