rs1553642657

Variant names:

• chr3-37008810-TCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG-T
• rs1553642657
• ENST00000458205.6:c.-270-3_-182delCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3 PP5_Moderate

The ENST00000458205.6(MLH1):​c.-270-3_-182delCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG variant causes a splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 31)
• Consequence: MLH1 ENST00000458205.6 splice_region
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.85
• Publications: 1 publications found

Genes affected

MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]

MLH1 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
• Lynch syndrome 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
• Muir-Torre syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
• Lynch syndrome 1

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• ovarian cancer

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• breast cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 3-37008810-TCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG-T is Pathogenic according to our data. Variant chr3-37008810-TCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 433874.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MLH1	NM_000249.4	c.456_545+2delGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGGCAGGT	p.Glu153_Arg182del	splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant	Exon 6 of 19	ENST00000231790.8	NP_000240.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MLH1	ENST00000231790.8	c.454-3_542delCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG	p.Val152fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 6 of 19	1	NM_000249.4	ENSP00000231790.3

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Lynch syndrome Pathogenic:1

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.8
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553642657; hg19: chr3-37050301;