rs1553642657

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PP3PP5_Moderate

The ENST00000458205.6(MLH1):​c.-270-3_-182delCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG variant causes a splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 31)

Consequence

MLH1
ENST00000458205.6 splice_region

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 8.85

Publications

1 publications found
Variant links:
Genes affected
MLH1 (HGNC:7127): (mutL homolog 1) The protein encoded by this gene can heterodimerize with mismatch repair endonuclease PMS2 to form MutL alpha, part of the DNA mismatch repair system. When MutL alpha is bound by MutS beta and some accessory proteins, the PMS2 subunit of MutL alpha introduces a single-strand break near DNA mismatches, providing an entry point for exonuclease degradation. The encoded protein is also involved in DNA damage signaling and can heterodimerize with DNA mismatch repair protein MLH3 to form MutL gamma, which is involved in meiosis. This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). [provided by RefSeq, Aug 2017]
MLH1 Gene-Disease associations (from GenCC):
  • Lynch syndrome
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, ClinGen, Orphanet
  • Lynch syndrome 2
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Genomics England PanelApp
  • Muir-Torre syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Genomics England PanelApp, Ambry Genetics, G2P, Orphanet
  • mismatch repair cancer syndrome 1
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae), Orphanet, ClinGen
  • Lynch syndrome 1
    Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
  • ovarian cancer
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • malignant pancreatic neoplasm
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • rhabdomyosarcoma
    Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
  • prostate cancer
    Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
  • breast cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: Ambry Genetics
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 3-37008810-TCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG-T is Pathogenic according to our data. Variant chr3-37008810-TCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 433874.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MLH1NM_000249.4 linkc.456_545+2delGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGGCAGGT p.Glu153_Arg182del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 6 of 19 ENST00000231790.8 NP_000240.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MLH1ENST00000231790.8 linkc.454-3_542delCAGGTGGAGGACCTTTTTTACAACATAGCCACGAGGAGAAAAGCTTTAAAAAATCCAAGTGAAGAATATGGGAAAATTTTGGAAGTTGTTGG p.Val152fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 6 of 19 1 NM_000249.4 ENSP00000231790.3

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Lynch syndrome Pathogenic:1
-
Department of Pathology and Laboratory Medicine, Sinai Health System
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.8
Mutation Taster
=0/200
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553642657; hg19: chr3-37050301; API