rs1553751262

Variant names:

• chr3-123448117-AGCCGCCGCCGCCGAGCCGCC-A
• rs1553751262
• NM_183357.3:c.409_428delGGCGGCTCGGCGGCGGCGGC

Your query was ambiguous. Multiple possible variants found:

• chr3-123448117-AGCCGCCGCCGCCGAGCCGCC-A
• chr3-123448117-AGCCGCCGCCGCCGAGCCGCC-AGCC
• chr3-123448117-AGCCGCCGCCGCCGAGCCGCC-AGCCGCCGCCGCCGAGCCGCCGCCGCCGCCGCCGAGCCGCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_183357.3(ADCY5):​c.409_428delGGCGGCTCGGCGGCGGCGGC​(p.Gly137CysfsTer184) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000105 in 948,302 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000011 (0 hom.)
• Consequence: ADCY5 NM_183357.3 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: 1.90
• Publications: 2 publications found

Genes affected

ADCY5 (HGNC:236): (adenylate cyclase 5) This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

ADCY5 Gene-Disease associations (from GenCC):

• dyskinesia with orofacial involvement, autosomal dominant

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• neurodevelopmental disorder

  Inheritance: AD Classification: STRONG Submitted by: G2P
• neurodevelopmental disorder with hyperkinetic movements and dyskinesia

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• familial dyskinesia and facial myokymia

  Inheritance: AD Classification: MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
• choreatic disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 3-123448117-AGCCGCCGCCGCCGAGCCGCC-A is Pathogenic according to our data. Variant chr3-123448117-AGCCGCCGCCGCCGAGCCGCC-A is described in ClinVar as Pathogenic. ClinVar VariationId is 521036.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ADCY5	NM_183357.3	c.409_428delGGCGGCTCGGCGGCGGCGGC	p.Gly137CysfsTer184	frameshift_variant	Exon 1 of 21	ENST00000462833.6	NP_899200.1
ADCY5	NM_001378259.1	c.409_428delGGCGGCTCGGCGGCGGCGGC	p.Gly137CysfsTer184	frameshift_variant	Exon 1 of 22		NP_001365188.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ADCY5	ENST00000462833.6	c.409_428delGGCGGCTCGGCGGCGGCGGC	p.Gly137CysfsTer184	frameshift_variant	Exon 1 of 21	1	NM_183357.3	ENSP00000419361.1
ADCY5	ENST00000850916.1	c.571_590delGGCGGCTCGGCGGCGGCGGC	p.Gly191CysfsTer184	frameshift_variant	Exon 1 of 21			ENSP00000520999.1
ADCY5	ENST00000699718.1	c.409_428delGGCGGCTCGGCGGCGGCGGC	p.Gly137CysfsTer184	frameshift_variant	Exon 1 of 22			ENSP00000514543.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000105 AC: 1 AN: 948302 Hom.: 0 AF XY: 0.00000222 AC XY: 1 AN XY: 449970

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 18244

American (AMR) AF: 0.00 AC: 0 AN: 4288

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 8572

East Asian (EAS) AF: 0.00 AC: 0 AN: 11230

South Asian (SAS) AF: 0.00 AC: 0 AN: 19926

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 11214

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2178

European-Non Finnish (NFE) AF: 0.00000119 AC: 1 AN: 838662

Other (OTH) AF: 0.00 AC: 0 AN: 33988

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

Inborn genetic diseases Pathogenic:1

Nov 27, 2019

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dyskinesia with orofacial involvement, autosomal recessive Pathogenic:1

Dec 09, 2021

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=18/182	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553751262; hg19: chr3-123166964;