rs1553769002

Variant names:

• chr3-122284035-G-GCATCCTGGTGAAAACCAACCGTGT
• rs1553769002
• NM_000388.4:c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_001178065.2(CASR):​c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC​(p.Ile705_Val712dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L713L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CASR NM_001178065.2 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.16
• Publications: 0 publications found

Genes affected

CASR (HGNC:1514): (calcium sensing receptor) The protein encoded by this gene is a plasma membrane G protein-coupled receptor that senses small changes in circulating calcium concentration. The encoded protein couples this information to intracellular signaling pathways that modify parathyroid hormone secretion or renal cation handling, and thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene are a cause of familial hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism, and autosomal dominant hypocalcemia. [provided by RefSeq, Aug 2017]

CASR Gene-Disease associations (from GenCC):

• autosomal dominant hypocalcemia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, ClinGen, Labcorp Genetics (formerly Invitae)
• familial hypocalciuric hypercalcemia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Illumina, Orphanet, Genomics England PanelApp
• neonatal severe primary hyperparathyroidism

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
• autosomal dominant hypocalcemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• epilepsy, idiopathic generalized, susceptibility to, 8

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 23 uncertain in NM_001178065.2
• PM4: Nonframeshift variant in NON repetitive region in NM_001178065.2.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001178065.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CASR	NM_000388.4	MANE Select	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	NP_000379.3
	CASR	NM_001178065.2		c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC	p.Ile705_Val712dup	conservative_inframe_insertion	Exon 7 of 7	NP_001171536.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CASR	ENST00000639785.2	TSL:1 MANE Select	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	ENSP00000491584.2
	CASR	ENST00000498619.4	TSL:1	c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC	p.Ile705_Val712dup	conservative_inframe_insertion	Exon 7 of 7	ENSP00000420194.1
	CASR	ENST00000638421.1	TSL:5	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	ENSP00000492190.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Autosomal dominant hypocalcemia 1;C1809471:Familial hypocalciuric hypercalcemia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553769002; hg19: chr3-122002882;