rs1553769002

Variant names:

• chr3-122284035-G-GCATCCTGGTGAAAACCAACCGTGT
• rs1553769002
• NM_000388.4:c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1 PM4

The NM_000388.4(CASR):​c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC​(p.Ile695_Val702dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L703L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CASR NM_000388.4 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 4.16
• Publications: 0 publications found

Genes affected

CASR (HGNC:1514): (calcium sensing receptor) The protein encoded by this gene is a plasma membrane G protein-coupled receptor that senses small changes in circulating calcium concentration. The encoded protein couples this information to intracellular signaling pathways that modify parathyroid hormone secretion or renal cation handling, and thus this protein plays an essential role in maintaining mineral ion homeostasis. Mutations in this gene are a cause of familial hypocalciuric hypercalcemia, neonatal severe hyperparathyroidism, and autosomal dominant hypocalcemia. [provided by RefSeq, Aug 2017]

CASR Gene-Disease associations (from GenCC):

• autosomal dominant hypocalcemia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, ClinGen, Labcorp Genetics (formerly Invitae)
• familial hypocalciuric hypercalcemia 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Illumina, Orphanet, Genomics England PanelApp
• neonatal severe primary hyperparathyroidism

  Inheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae)
• autosomal dominant hypocalcemia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• epilepsy, idiopathic generalized, susceptibility to, 8

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• epilepsy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 23 uncertain in NM_000388.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000388.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CASR	NM_000388.4	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	ENST00000639785.2	NP_000379.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CASR	ENST00000639785.2	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	1	NM_000388.4	ENSP00000491584.2
CASR	ENST00000498619.4	c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC	p.Ile705_Val712dup	conservative_inframe_insertion	Exon 7 of 7	1		ENSP00000420194.1
CASR	ENST00000638421.1	c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC	p.Ile695_Val702dup	conservative_inframe_insertion	Exon 7 of 7	5		ENSP00000492190.1
CASR	ENST00000490131.7	c.1852_1875dupATCCTGGTGAAAACCAACCGTGTC	p.Ile618_Val625dup	conservative_inframe_insertion	Exon 5 of 5	5		ENSP00000418685.2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 33

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Autosomal dominant hypocalcemia 1;C1809471:Familial hypocalciuric hypercalcemia Uncertain:1

Nov 13, 2016

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change inserts 24 nucleotides in exon 7 of the CASR mRNA (c.2083_2106dup). This leads to the insertion of 8 amino acid residues in the CASR protein (p.Ile695_Val702dup) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a CASR-related disease. Experimental studies and protein prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may alter RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, this variant is a novel duplication with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553769002; hg19: chr3-122002882;