rs1553769002
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4
The NM_000388.4(CASR):c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC(p.Ile695_Val702dup) variant causes a conservative inframe insertion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L703L) has been classified as Likely benign.
Frequency
Consequence
NM_000388.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant hypocalcemia 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, Labcorp Genetics (formerly Invitae), ClinGen
- familial hypocalciuric hypercalcemia 1Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Illumina, Orphanet, ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- neonatal severe primary hyperparathyroidismInheritance: AR, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- autosomal dominant hypocalcemiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- epilepsy, idiopathic generalized, susceptibility to, 8Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
- epilepsyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000388.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CASR | MANE Select | c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC | p.Ile695_Val702dup | conservative_inframe_insertion | Exon 7 of 7 | NP_000379.3 | |||
| CASR | c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC | p.Ile705_Val712dup | conservative_inframe_insertion | Exon 7 of 7 | NP_001171536.2 | P41180-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CASR | TSL:1 MANE Select | c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC | p.Ile695_Val702dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000491584.2 | P41180-1 | ||
| CASR | TSL:1 | c.2113_2136dupATCCTGGTGAAAACCAACCGTGTC | p.Ile705_Val712dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000420194.1 | P41180-2 | ||
| CASR | TSL:5 | c.2083_2106dupATCCTGGTGAAAACCAACCGTGTC | p.Ile695_Val702dup | conservative_inframe_insertion | Exon 7 of 7 | ENSP00000492190.1 | P41180-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 33
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at