rs1553801591

Variant names:

• chr4-625794-C-CACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT
• rs1553801591
• NM_000283.4:c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_000283.4(PDE6B):​c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT​(p.Leu83CysfsTer91) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,012 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000021 (0 hom.)
• Consequence: PDE6B NM_000283.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:2
• Conservation: PhyloP100: -0.0170
• Publications: 0 publications found

Genes affected

PDE6B (HGNC:8786): (phosphodiesterase 6B) Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]

PDE6B Gene-Disease associations (from GenCC):

• retinitis pigmentosa 40

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine
• congenital stationary night blindness autosomal dominant 2

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• congenital stationary night blindness

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• retinitis pigmentosa

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 4-625794-C-CACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT is Pathogenic according to our data. Variant chr4-625794-C-CACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 13108.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PDE6B	NM_000283.4	c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT	p.Leu83CysfsTer91	frameshift_variant	Exon 1 of 22	ENST00000496514.6	NP_000274.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PDE6B	ENST00000496514.6	c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT	p.Leu83CysfsTer91	frameshift_variant	Exon 1 of 22	1	NM_000283.4	ENSP00000420295.1
PDE6B	ENST00000255622.10	c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT	p.Leu83CysfsTer91	frameshift_variant	Exon 1 of 22	1		ENSP00000255622.6

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000205 AC: 3 AN: 1461012 Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1 AN XY: 726854

African (AFR) AF: 0.00 AC: 0 AN: 33474

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26120

East Asian (EAS) AF: 0.00 AC: 0 AN: 39694

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52700

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00000270 AC: 3 AN: 1111900

Other (OTH) AF: 0.00 AC: 0 AN: 60384

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Aug 20, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. ClinVar contains an entry for this variant (Variation ID: 13108). This premature translational stop signal has been observed in individual(s) with retinitis pigmentosa (PMID: 7599633). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Leu83Cysfs*91) in the PDE6B gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PDE6B are known to be pathogenic (PMID: 8394174, 8595886, 22334370). -

Retinitis pigmentosa 40 Pathogenic:1

Jan 01, 1995

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.017
Mutation Taster		=16/184	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553801591; hg19: chr4-619583;