rs1553801591
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_000283.4(PDE6B):c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT(p.Leu83CysfsTer91) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000205 in 1,461,012 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000283.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- inherited retinal dystrophyInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- retinitis pigmentosa 40Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine, G2P
- congenital stationary night blindness autosomal dominant 2Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
- congenital stationary night blindnessInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- retinitis pigmentosaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000283.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDE6B | MANE Select | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83CysfsTer91 | frameshift | Exon 1 of 22 | NP_000274.3 | P35913-1 | ||
| PDE6B | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83CysfsTer91 | frameshift | Exon 1 of 22 | NP_001427476.1 | ||||
| PDE6B | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83CysfsTer91 | frameshift | Exon 1 of 22 | NP_001138763.2 | P35913-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PDE6B | TSL:1 MANE Select | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83CysfsTer91 | frameshift | Exon 1 of 22 | ENSP00000420295.1 | P35913-1 | ||
| PDE6B | TSL:1 | c.169_239dupACGGCGCTGCTGGAGCTGGTGCAGGATATGCAGGAGAGCATCAACATGGAGCGCGTGGTCTTCAAGGTCCT | p.Leu83CysfsTer91 | frameshift | Exon 1 of 22 | ENSP00000255622.6 | P35913-2 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461012Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1AN XY: 726854 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at