rs1553878395

Variant names:

• chr4-25127262-ACCTAAAGATATGGGATTGTGAGGTGTATGCAACAGTCTTTCATTGTAGGCTTCTGACAACTTCTTTATTTGGTTGGACAAATATGAAAACATTT-A
• rs1553878395
• ENST00000358971.7:n.*826_*918+1delAAATGTTTTCATATTTGTCCAACCAAATAAAGAAGTTGTCAGAAGCCTACAATGAAAGACTGTTGCATACACCTCACAATCCCATATCTTTAGG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3 PP5

The ENST00000358971.7(SEPSECS):​n.*826_*918+1delAAATGTTTTCATATTTGTCCAACCAAATAAAGAAGTTGTCAGAAGCCTACAATGAAAGACTGTTGCATACACCTCACAATCCCATATCTTTAGG variant causes a splice region, non coding transcript exon change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SEPSECS ENST00000358971.7 splice_region, non_coding_transcript_exon
• Clinical Significance: Likely pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.69
• Publications: 1 publications found

Genes affected

SEPSECS (HGNC:30605): (Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase) The amino acid selenocysteine is the only amino acid that does not have its own tRNA synthetase. Instead, this amino acid is synthesized on its cognate tRNA in a three step process. The protein encoded by this gene catalyzes the third step in the process, the conversion of O-phosphoseryl-tRNA(Sec) to selenocysteinyl-tRNA(Sec).[provided by RefSeq, Mar 2011]

SEPSECS Gene-Disease associations (from GenCC):

• pontocerebellar hypoplasia type 2D

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Broad Center for Mendelian Genomics, PanelApp Australia, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• pontocerebellar hypoplasia type 2

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• progressive cerebello-cerebral atrophy

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 4-25127262-ACCTAAAGATATGGGATTGTGAGGTGTATGCAACAGTCTTTCATTGTAGGCTTCTGACAACTTCTTTATTTGGTTGGACAAATATGAAAACATTT-A is Pathogenic according to our data. Variant chr4-25127262-ACCTAAAGATATGGGATTGTGAGGTGTATGCAACAGTCTTTCATTGTAGGCTTCTGACAACTTCTTTATTTGGTTGGACAAATATGAAAACATTT-A is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 183337.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SEPSECS	NM_016955.4	c.1028_1120+1delAAATGTTTTCATATTTGTCCAACCAAATAAAGAAGTTGTCAGAAGCCTACAATGAAAGACTGTTGCATACACCTCACAATCCCATATCTTTAGG	p.Glu343_Leu373del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 11	ENST00000382103.7	NP_058651.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SEPSECS	ENST00000382103.7	c.1028_1120+1delAAATGTTTTCATATTTGTCCAACCAAATAAAGAAGTTGTCAGAAGCCTACAATGAAAGACTGTTGCATACACCTCACAATCCCATATCTTTAGG	p.Glu343_Leu373del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 9 of 11	1	NM_016955.4	ENSP00000371535.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Cerebellar ataxia;C0013362:Dysarthria;C0023882:Spastic diplegia;C0027746:Neurodegeneration;C1321325:Elliptical nystagmus;C3509787:Progressive limb weakness Pathogenic:1

Dec 01, 2014

Genomic Medicine Center of Excellence, King Faisal Specialist Hospital and Research Centre

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1553878395; hg19: chr4-25128884;