rs1554011754

Variant names:

• chr4-112647351-GAACCCCAAAAGCAGTGCTCAAAGAAAAAGAAAAAACGGGACAGAGTTGAAGCATCTAGCTTACCTGAAGTCAGAACAGGGAAGAGGAAGAGAAGCAGCTCTGAAGATGCAGAATCCCTAGCTCCCCGATCAAAAGTAAAGAAAATTATTCAGAAAGACATCATTAAGGAAGCATCAGAAGCTTCCAAGGAAAATAGAGGTAAAACTACAAGGTTTTAATTAGATAAAACTAATTAATTTTAATTAATTAGTTTTTAATTAATTAGGTTTTAATTGGCTTCTGTTTCACCCATTTCACAGCCCCATGTCTTAACGGAGAGCTTTTTTATTTATTTCAAGATATAGAAATCTCTACTGAAGAGGAAAAGGATACTGGAGATCTAAAAGATAGCTCTCTCTTGAAAACAAAAAGGAAACATAAGAAAAAACATAAAGAGAGACATAAAATGGGAGAAGAAGTTATACCATTAAGAGTGCTATCAAAGTAAGTCTGTGGTTTAAATTCTGTCATTGGCTTAACAATCCATCACCATTGCTAAAGTGCAATTCCAATTTATATTCAACAGAGTTGCATATTAGCAACAGTAATGGCCTGTAGCCAAGAACTGCACACAGTGTGGGCGTTAACGCAATTGCTGATTAGGTAGGAACCACCACACTCAAACATGGAAGCACTTATTTTTGTCATGTCACAGCAAGTGCCTCCATGTTAAAGTAGAGGGGGCCCCTTAACAGATGTAAAAATACAA-G
• rs1554011754
• ENST00000509622.5:n.*561_*901+267del

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4 PP5_Moderate

The ENST00000509622.5(LARP7):​n.*561_*901+267del variant causes a conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: LARP7 ENST00000509622.5 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.88
• Publications: 0 publications found

Genes affected

LARP7 (HGNC:24912): (La ribonucleoprotein 7, transcriptional regulator) This gene encodes a protein which is found in the 7SK snRNP (small nuclear ribonucleoprotein). This snRNP complex inhibits a cyclin-dependent kinase, positive transcription elongation factor b, which is required for paused RNA polymerase II at a promoter to begin transcription elongation. A pseudogene of this gene is located on chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]

MIR302CHG (HGNC:41070): (miR-302/367 cluster host gene)

MIR302D (HGNC:31765): (microRNA 302d) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

MIR367 (HGNC:31781): (microRNA 367) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

MIR302A (HGNC:31623): (microRNA 302a) microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in ENST00000509622.5.
• PP5: Variant 4-112647351-GAACCCCAAAAGCAGTGCTCAAAGAAAAAGAAAAAACGGGACAGAGTTGAAGCATCTAGCTTACCTGAAGTCAGAACAGGGAAGAGGAAGAGAAGCAGCTCTGAAGATGCAGAATCCCTAGCTCCCCGATCAAAAGTAAAGAAAATTATTCAGAAAGACATCATTAAGGAAGCATCAGAAGCTTCCAAGGAAAATAGAGGTAAAACTACAAGGTTTTAATTAGATAAAACTAATTAATTTTAATTAATTAGTTTTTAATTAATTAGGTTTTAATTGGCTTCTGTTTCACCCATTTCACAGCCCCATGTCTTAACGGAGAGCTTTTTTATTTATTTCAAGATATAGAAATCTCTACTGAAGAGGAAAAGGATACTGGAGATCTAAAAGATAGCTCTCTCTTGAAAACAAAAAGGAAACATAAGAAAAAACATAAAGAGAGACATAAAATGGGAGAAGAAGTTATACCATTAAGAGTGCTATCAAAGTAAGTCTGTGGTTTAAATTCTGTCATTGGCTTAACAATCCATCACCATTGCTAAAGTGCAATTCCAATTTATATTCAACAGAGTTGCATATTAGCAACAGTAATGGCCTGTAGCCAAGAACTGCACACAGTGTGGGCGTTAACGCAATTGCTGATTAGGTAGGAACCACCACACTCAAACATGGAAGCACTTATTTTTGTCATGTCACAGCAAGTGCCTCCATGTTAAAGTAGAGGGGGCCCCTTAACAGATGTAAAAATACAA-G is Pathogenic according to our data. Variant chr4-112647351-GAACCCCAAAAGCAGTGCTCAAAGAAAAAGAAAAAACGGGACAGAGTTGAAGCATCTAGCTTACCTGAAGTCAGAACAGGGAAGAGGAAGAGAAGCAGCTCTGAAGATGCAGAATCCCTAGCTCCCCGATCAAAAGTAAAGAAAATTATTCAGAAAGACATCATTAAGGAAGCATCAGAAGCTTCCAAGGAAAATAGAGGTAAAACTACAAGGTTTTAATTAGATAAAACTAATTAATTTTAATTAATTAGTTTTTAATTAATTAGGTTTTAATTGGCTTCTGTTTCACCCATTTCACAGCCCCATGTCTTAACGGAGAGCTTTTTTATTTATTTCAAGATATAGAAATCTCTACTGAAGAGGAAAAGGATACTGGAGATCTAAAAGATAGCTCTCTCTTGAAAACAAAAAGGAAACATAAGAAAAAACATAAAGAGAGACATAAAATGGGAGAAGAAGTTATACCATTAAGAGTGCTATCAAAGTAAGTCTGTGGTTTAAATTCTGTCATTGGCTTAACAATCCATCACCATTGCTAAAGTGCAATTCCAATTTATATTCAACAGAGTTGCATATTAGCAACAGTAATGGCCTGTAGCCAAGAACTGCACACAGTGTGGGCGTTAACGCAATTGCTGATTAGGTAGGAACCACCACACTCAAACATGGAAGCACTTATTTTTGTCATGTCACAGCAAGTGCCTCCATGTTAAAGTAGAGGGGGCCCCTTAACAGATGTAAAAATACAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 211371.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LARP7	NM_016648.4	c.802_1142+267del		exon_loss_variant	Exon 8 of 13	ENST00000344442.10	NP_057732.2
LARP7	NM_016648.4	c.802_1142+267del	p.Pro268AspfsTer42	frameshift_variant	Exon 7 of 13	ENST00000344442.10	NP_057732.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LARP7	ENST00000344442.10	c.802_1142+267del		exon_loss_variant	Exon 8 of 13	2	NM_016648.4	ENSP00000344950.5
LARP7	ENST00000344442.10	c.802_1142+267del	p.Pro268AspfsTer42	frameshift_variant	Exon 8 of 13	2	NM_016648.4	ENSP00000344950.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Microcephalic primordial dwarfism, Alazami type Pathogenic:1

Jul 02, 2015

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554011754; hg19: chr4-113568507;