rs1554065670

Variant names:

• chr5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T
• rs1554065670
• NM_000414.4:c.1212_1261+2delTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_000414.4(HSD17B4):​c.1212_1261+2delTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGT​(p.Leu405fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HSD17B4 NM_000414.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.32
• Publications: 0 publications found

Genes affected

HSD17B4 (HGNC:5213): (hydroxysteroid 17-beta dehydrogenase 4) The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]

HSD17B4 Gene-Disease associations (from GenCC):

• d-bifunctional protein deficiency

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: ClinGen, Myriad Women’s Health, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• Perrault syndrome

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Perrault syndrome 1

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T is Pathogenic according to our data. Variant chr5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 7653.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HSD17B4	NM_000414.4	c.1212_1261+2delTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGT	p.Leu405fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 14 of 24	ENST00000510025.7	NP_000405.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HSD17B4	ENST00000510025.7	c.1210-2_1259delAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC	p.Val404fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 14 of 24	2	NM_000414.4	ENSP00000424940.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Bifunctional peroxisomal enzyme deficiency Pathogenic:1

Nov 01, 1997

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.3
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554065670; hg19: chr5-118837733;