rs1554065670

Variant names:

• chr5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T
• rs1554065670
• NM_000414.4:c.1212_1261+2delTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGT

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The ENST00000510025.7(HSD17B4):​c.1210-2_1259delAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC​(p.Val404fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HSD17B4 ENST00000510025.7 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.32

Genes affected

HSD17B4 (HGNC:5213): (hydroxysteroid 17-beta dehydrogenase 4) The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T is Pathogenic according to our data. Variant chr5-119502038-TAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC-T is described in ClinVar as [Pathogenic]. Clinvar id is 7653.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HSD17B4	NM_000414.4	c.1212_1261+2delTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGT	p.Leu405fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 14 of 24	ENST00000510025.7	NP_000405.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HSD17B4	ENST00000510025.7	c.1210-2_1259delAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGC	p.Val404fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 14 of 24	2	NM_000414.4	ENSP00000424940.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Bifunctional peroxisomal enzyme deficiency Pathogenic:1

Nov 01, 1997

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554065670; hg19: chr5-118837733;