rs1554079988

Variant names:

• chr5-112819078-AGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG-A
• rs1554079988
• NM_000038.6:c.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000038.6(APC):​c.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG​(p.Ser350ProfsTer73) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. S350S) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: APC NM_000038.6 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 10.0
• Publications: 0 publications found

Genes affected

APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

APC Gene-Disease associations (from GenCC):

• classic or attenuated familial adenomatous polyposis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• desmoid tumor

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
• familial adenomatous polyposis 1

  Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• gastric adenocarcinoma and proximal polyposis of the stomach

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
• sarcoma

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• APC-related attenuated familial adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Turcot syndrome with polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cenani-Lenz syndactyly syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 5-112819078-AGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG-A is Pathogenic according to our data. Variant chr5-112819078-AGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG-A is described in ClinVar as Pathogenic. ClinVar VariationId is 433616.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
APC	NM_000038.6	c.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG	p.Ser350ProfsTer73	frameshift_variant	Exon 10 of 16	ENST00000257430.9	NP_000029.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
APC	ENST00000257430.9	c.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG	p.Ser350ProfsTer73	frameshift_variant	Exon 10 of 16	5	NM_000038.6	ENSP00000257430.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Familial multiple polyposis syndrome Pathogenic:1

-

Department of Pathology and Laboratory Medicine, Sinai Health System

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Pathogenic:1

May 24, 2017

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This deletion of 94 nucleotides in APC is denoted c.1048_1141del94 at the cDNA level and p.Ser350ProfsX73 (S350PfsX73) at the protein level. The surrounding sequence is ACAG[del94]CCAG. The deletion causes a frameshift which changes a Serine to a Proline at codon 350, and creates a premature stop codon at position 73 of the new reading frame. Although this variant has not, to our knowledge, been reported in the literature, it is predicted to cause loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay. Based on the currently available information, we consider this deletion to be a likely pathogenic variant. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554079988; hg19: chr5-112154775;