rs1554079988

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000038.6(APC):​c.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG​(p.Ser350fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

APC
NM_000038.6 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 10.0
Variant links:
Genes affected
APC (HGNC:583): (APC regulator of WNT signaling pathway) This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Mutations in the APC gene have been found to occur in most colorectal cancers, where disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jun 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 5-112819078-AGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG-A is Pathogenic according to our data. Variant chr5-112819078-AGTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGG-A is described in ClinVar as [Pathogenic]. Clinvar id is 433616.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect #exon/exons MANE Protein UniProt
APCNM_000038.6 linkuse as main transcriptc.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG p.Ser350fs frameshift_variant 10/16 ENST00000257430.9 NP_000029.2 P25054-1Q4LE70

Ensembl

Gene Transcript HGVSc HGVSp Effect #exon/exons TSL MANE Protein Appris UniProt
APCENST00000257430.9 linkuse as main transcriptc.1048_1141delTCTGGATGTCTTCCTCTCCTCATCCAGCTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAGGCTCGGG p.Ser350fs frameshift_variant 10/165 NM_000038.6 ENSP00000257430.4 P25054-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Familial multiple polyposis syndrome Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingDepartment of Pathology and Laboratory Medicine, Sinai Health System-- -
not provided Pathogenic:1
Pathogenic, criteria provided, single submitterclinical testingGeneDxMay 24, 2017This deletion of 94 nucleotides in APC is denoted c.1048_1141del94 at the cDNA level and p.Ser350ProfsX73 (S350PfsX73) at the protein level. The surrounding sequence is ACAG[del94]CCAG. The deletion causes a frameshift which changes a Serine to a Proline at codon 350, and creates a premature stop codon at position 73 of the new reading frame. Although this variant has not, to our knowledge, been reported in the literature, it is predicted to cause loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay. Based on the currently available information, we consider this deletion to be a likely pathogenic variant. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554079988; hg19: chr5-112154775; API