rs1554095263

Variant names:

• chr5-177386492-G-GGATCCTGGTGACCGTGCTGGT
• rs1554095263
• NM_003052.5:c.460_480dupATCCTGGTGACCGTGCTGGTG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP5

The NM_003052.5(SLC34A1):​c.460_480dupATCCTGGTGACCGTGCTGGTG​(p.Ile154_Val160dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000167 in 1,614,070 control chromosomes in the GnomAD database, including 1 homozygotes. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000016 (1 hom.)
• Consequence: SLC34A1 NM_003052.5 conservative_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:2 U:1
• Conservation: PhyloP100: -0.0240
• Publications: 0 publications found

Genes affected

SLC34A1 (HGNC:11019): (solute carrier family 34 member 1) Enables sodium:phosphate symporter activity. Involved in several processes, including phosphate ion homeostasis; phosphate ion transport; and response to lead ion. Located in several cellular components, including apical plasma membrane; mitotic spindle; and nuclear speck. Implicated in several diseases, including Fanconi syndrome (multiple); chronic kidney disease; hereditary hypophosphatemic rickets with hypercalciuria; hypophosphatemic nephrolithiasis/osteoporosis 1; and nephrolithiasis. [provided by Alliance of Genome Resources, Apr 2022]

SLC34A1 Gene-Disease associations (from GenCC):

• hypercalcemia, infantile, 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae), ClinGen
• hypophosphatemic nephrolithiasis/osteoporosis 1

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• dominant hypophosphatemia with nephrolithiasis or osteoporosis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• primary Fanconi syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• autosomal recessive infantile hypercalcemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• Fanconi renotubular syndrome 2

  Inheritance: AR Classification: LIMITED, NO_KNOWN Submitted by: Labcorp Genetics (formerly Invitae), ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 3 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 4 uncertain in NM_003052.5
• PM4: Nonframeshift variant in NON repetitive region in NM_003052.5.
• PP5: Variant 5-177386492-G-GGATCCTGGTGACCGTGCTGGT is Pathogenic according to our data. Variant chr5-177386492-G-GGATCCTGGTGACCGTGCTGGT is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 12933.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003052.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A1	NM_003052.5	MANE Select	c.460_480dupATCCTGGTGACCGTGCTGGTG	p.Ile154_Val160dup	conservative_inframe_insertion	Exon 5 of 13	NP_003043.3
	SLC34A1	NM_001167579.2		c.460_480dupATCCTGGTGACCGTGCTGGTG	p.Ile154_Val160dup	conservative_inframe_insertion	Exon 5 of 9	NP_001161051.1	Q06495-2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SLC34A1	ENST00000324417.6	TSL:1 MANE Select	c.460_480dupATCCTGGTGACCGTGCTGGTG	p.Ile154_Val160dup	conservative_inframe_insertion	Exon 5 of 13	ENSP00000321424.4	Q06495-1
	SLC34A1	ENST00000872468.1		c.460_480dupATCCTGGTGACCGTGCTGGTG	p.Ile154_Val160dup	conservative_inframe_insertion	Exon 5 of 13	ENSP00000542527.1
	SLC34A1	ENST00000512593.5	TSL:2	c.460_480dupATCCTGGTGACCGTGCTGGTG	p.Ile154_Val160dup	conservative_inframe_insertion	Exon 5 of 9	ENSP00000423022.1	Q06495-2

Frequencies

GnomAD3 genomes AF: 0.0000197 AC: 3 AN: 152196 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.000478

GnomAD2 exomes AF: 0.0000199 AC: 5 AN: 251404 AF XY: 0.0000294

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000440

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000164 AC: 24 AN: 1461874 Hom.: 1 Cov.: 34 AF XY: 0.0000151 AC XY: 11 AN XY: 727244

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.00 AC: 0 AN: 44724

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86256

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53404

Middle Eastern (MID) AF: 0.000693 AC: 4 AN: 5768

European-Non Finnish (NFE) AF: 0.0000171 AC: 19 AN: 1112012

Other (OTH) AF: 0.0000166 AC: 1 AN: 60394

GnomAD4 genome AF: 0.0000197 AC: 3 AN: 152196 Hom.: 0 Cov.: 32 AF XY: 0.0000134 AC XY: 1 AN XY: 74356

African (AFR) AF: 0.00 AC: 0 AN: 41454

American (AMR) AF: 0.00 AC: 0 AN: 15292

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5188

South Asian (SAS) AF: 0.00 AC: 0 AN: 4834

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10620

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000294 AC: 2 AN: 68018

Other (OTH) AF: 0.000478 AC: 1 AN: 2090

Alfa AF: 0.000111 Hom.: 0

EpiCase AF: 0.0000545

EpiControl AF: 0.000119

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	-	-	Fanconi renotubular syndrome 2 (1)
1	-	-	Hypophosphatemic nephrolithiasis/osteoporosis 1;C3150652:Fanconi renotubular syndrome 2;C4310473:Hypercalcemia, infantile, 2 (1)
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.024
Mutation Taster		=66/34	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554095263; hg19: chr5-176813493;