rs1554183440

Variant names:

• chr6-64590525-ACTGAGCCTGTCAATGGTGGCAGATT-TA
• rs1554183440
• NM_001142800.2:c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_001142800.2(EYS):​c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA​(p.Asn1773_Val1781delinsTer) variant causes a stop gained, conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: EYS NM_001142800.2 stop_gained, conservative_inframe_deletion
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 0.332

Genes affected

EYS (HGNC:21555): (eyes shut homolog) The product of this gene contains multiple epidermal growth factor (EGF)-like and LamG domains. The protein is expressed in the photoreceptor layer of the retina, and the gene is mutated in autosomal recessive retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 6-64590525-ACTGAGCCTGTCAATGGTGGCAGATT-TA is Pathogenic according to our data. Variant chr6-64590525-ACTGAGCCTGTCAATGGTGGCAGATT-TA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 438198.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EYS	NM_001142800.2	c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA	p.Asn1773_Val1781delinsTer	stop_gained, conservative_inframe_deletion		ENST00000503581.6	NP_001136272.1
EYS	NM_001292009.2	c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA	p.Asn1773_Val1781delinsTer	stop_gained, conservative_inframe_deletion			NP_001278938.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EYS	ENST00000503581.6	c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA	p.Asn1773_Val1781delinsTer	stop_gained, conservative_inframe_deletion		5	NM_001142800.2	ENSP00000424243.1
EYS	ENST00000370621.7	c.5317_5342delAATCTGCCACCATTGACAGGCTCAGTinsTA	p.Asn1773_Val1781delinsTer	stop_gained, conservative_inframe_deletion		1		ENSP00000359655.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Retinitis pigmentosa 25 Pathogenic:1

Feb 20, 2023

Baylor Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Retinal dystrophy Pathogenic:1

Jul 26, 2019

Blueprint Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Retinitis pigmentosa Pathogenic:1

Jan 01, 2015

NIHR Bioresource Rare Diseases, University of Cambridge

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: research

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554183440; hg19: chr6-65300418;