rs1554251571
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_006073.4(TRDN):c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG(p.Ala202fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A202A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_006073.4 frameshift, splice_donor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- catecholaminergic polymorphic ventricular tachycardiaInheritance: AD, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- catecholaminergic polymorphic ventricular tachycardia 5Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
- familial long QT syndromeInheritance: AR Classification: STRONG Submitted by: G2P
- long QT syndromeInheritance: AR Classification: STRONG Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_006073.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TRDN | NM_006073.4 | MANE Select | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 41 | NP_006064.2 | ||
| TRDN | NM_001251987.2 | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 21 | NP_001238916.1 | |||
| TRDN | NM_001407315.1 | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 20 | NP_001394244.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TRDN | ENST00000334268.9 | TSL:1 MANE Select | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 41 | ENSP00000333984.5 | ||
| TRDN | ENST00000628709.2 | TSL:1 | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 9 | ENSP00000486095.1 | ||
| TRDN | ENST00000546248.6 | TSL:1 | c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG | p.Ala202fs | frameshift splice_donor splice_region intron | Exon 7 of 8 | ENSP00000439281.2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at