rs1554251571

Variant names:

• chr6-123512255-TCAGAGTAAAAAGAATTTAGTTATGGAAATAATAAATTGAAAAGTTACCTTTCGC-T
• rs1554251571
• NM_006073.4:c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG

Variant summary

Our verdict is Pathogenic. Variant got 10 ACMG points: 10P and 0B. PVS1 PM2

The NM_006073.4(TRDN):​c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG​(p.Ala202fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: TRDN NM_006073.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 1.98

Genes affected

TRDN (HGNC:12261): (triadin) This gene encodes an integral membrane protein found in skeletal and cardiac muscle. The encoded protein plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex and is required for normal skeletal muscle strength. This protein indirectly links triads and microtubules in skeletal muscle. Mutations in this gene are associated with cardiac arrythmia syndrome and some variants in this gene may be associated with sudden cardiac death. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TRDN	NM_006073.4	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 41	ENST00000334268.9	NP_006064.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TRDN	ENST00000334268.9	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 7 of 41	1	NM_006073.4	ENSP00000333984.5

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Nov 23, 2015

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The c.604_610+4 7del variant in TRDN has not been previously reported in individuals with cardio myopathy. Data from large population studies is insufficient to assess the frequ ency of this variant. This variant is a deletion of 54 bases starting at positio n c.604 and extending 47 bases into intron 7. This deletion removes the 5' splic e region of intron 7, is predicted to alter the protein reading-frame, and leads to an altered or absent protein. While there is some evidence that loss of fun ction in TRDN is associated with catecholaminergic polymorphic ventricular tachy cardia and long QT syndrome in an autosomal recessive manner, the evidence is li mited. In summary, while there is some suspicion for a pathogenic role, the clin ical significance of the the c.604_610+47del variant is uncertain. -

Catecholaminergic polymorphic ventricular tachycardia 1 Uncertain:1

Dec 18, 2023

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 7 (c.604_610+47del) of the TRDN gene. While this variant is not anticipated to result in nonsense mediated decay, it likely alters RNA splicing and results in a disrupted protein product. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with TRDN-related conditions. ClinVar contains an entry for this variant (Variation ID: 229351). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554251571; hg19: chr6-123833400;