rs1554251571

Variant names:

• chr6-123512255-TCAGAGTAAAAAGAATTTAGTTATGGAAATAATAAATTGAAAAGTTACCTTTCGC-T
• rs1554251571
• NM_006073.4:c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_006073.4(TRDN):​c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG​(p.Ala202fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. A202A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 31)
• Consequence: TRDN NM_006073.4 frameshift, splice_donor, splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 1.98
• Publications: 0 publications found

Genes affected

TRDN (HGNC:12261): (triadin) This gene encodes an integral membrane protein found in skeletal and cardiac muscle. The encoded protein plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex and is required for normal skeletal muscle strength. This protein indirectly links triads and microtubules in skeletal muscle. Mutations in this gene are associated with cardiac arrythmia syndrome and some variants in this gene may be associated with sudden cardiac death. [provided by RefSeq, May 2022]

TRDN Gene-Disease associations (from GenCC):

• catecholaminergic polymorphic ventricular tachycardia

  Inheritance: AD, AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• catecholaminergic polymorphic ventricular tachycardia 5

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp
• familial long QT syndrome

  Inheritance: AR Classification: STRONG Submitted by: G2P
• long QT syndrome

  Inheritance: AR Classification: STRONG Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_006073.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TRDN	NM_006073.4	MANE Select	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 41	NP_006064.2
	TRDN	NM_001251987.2		c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 21	NP_001238916.1
	TRDN	NM_001407315.1		c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 20	NP_001394244.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TRDN	ENST00000334268.9	TSL:1 MANE Select	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 41	ENSP00000333984.5
	TRDN	ENST00000628709.2	TSL:1	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 9	ENSP00000486095.1
	TRDN	ENST00000546248.6	TSL:1	c.604_610+47delGCGAAAGGTAACTTTTCAATTTATTATTTCCATAACTAAATTCTTTTTACTCTG	p.Ala202fs	frameshift splice_donor splice_region intron	Exon 7 of 8	ENSP00000439281.2

Frequencies

GnomAD3 genomes Cov.: 31

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 31

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	1	-	Catecholaminergic polymorphic ventricular tachycardia 1 (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554251571; hg19: chr6-123833400;