rs1554306440

Variant names:

• chr7-6005947-GCTTAGACTCAGTACCACCTGCCCAGAGCAA-G
• rs1554306440
• NM_000535.7:c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_000535.7(PMS2):​c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG​(p.Cys27_Ser36del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000096 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: PMS2 NM_000535.7 disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 8.91
• Publications: 0 publications found

Genes affected

PMS2 (HGNC:9122): (PMS1 homolog 2, mismatch repair system component) The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]

PMS2 Gene-Disease associations (from GenCC):

• Lynch syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• Lynch syndrome 4

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• mismatch repair cancer syndrome 1

  Inheritance: AR Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• mismatch repair cancer syndrome 4

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• malignant pancreatic neoplasm

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• ovarian cancer

  Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
• Muir-Torre syndrome

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• rhabdomyosarcoma

  Inheritance: AR Classification: MODERATE Submitted by: Genomics England PanelApp
• breast cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• prostate cancer

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_000535.7.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000535.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PMS2	NM_000535.7	MANE Select	c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG	p.Cys27_Ser36del	disruptive_inframe_deletion	Exon 2 of 15	NP_000526.2
	PMS2	NM_001406866.1		c.264_293delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG	p.Cys89_Ser98del	disruptive_inframe_deletion	Exon 3 of 16	NP_001393795.1
	PMS2	NM_001322014.2		c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG	p.Cys27_Ser36del	disruptive_inframe_deletion	Exon 2 of 15	NP_001308943.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PMS2	ENST00000265849.12	TSL:1 MANE Select	c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG	p.Cys27_Ser36del	disruptive_inframe_deletion	Exon 2 of 15	ENSP00000265849.7
	PMS2	ENST00000382321.5	TSL:1	c.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG	p.Cys27_Ser36del	disruptive_inframe_deletion	Exon 2 of 11	ENSP00000371758.4
	PMS2	ENST00000406569.8	TSL:1	n.78_107delTTGCTCTGGGCAGGTGGTACTGAGTCTAAG		non_coding_transcript_exon	Exon 2 of 13	ENSP00000514464.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000960 AC: 14 AN: 1458554 Hom.: 0 AF XY: 0.00000689 AC XY: 5 AN XY: 725602

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33406

American (AMR) AF: 0.00 AC: 0 AN: 44716

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26126

East Asian (EAS) AF: 0.00 AC: 0 AN: 39686

South Asian (SAS) AF: 0.00 AC: 0 AN: 86164

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52308

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4136

European-Non Finnish (NFE) AF: 0.0000117 AC: 13 AN: 1111818

Other (OTH) AF: 0.0000166 AC: 1 AN: 60194

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary cancer-predisposing syndrome Uncertain:1

Oct 02, 2017

Color Diagnostics, LLC DBA Color Health

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554306440; hg19: chr7-6045578;