rs1554306445

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000535.7(PMS2):​c.24-12_107delTGATTTCTCTAGTACAGAACCTGCTAAGGCCATCAAACCTATTGATCGGAAGTCAGTCCATCAGATTTGCTCTGGGCAGGTGGTACTGAGTCTAAGinsAAAT​(p.Thr9fs) variant causes a frameshift, splice acceptor, missense, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Another variant affecting the same amino acid position, but resulting in a different missense (i.e. STEPAKAIKPIDRKSVHQICSGQVVLSLS8?) has been classified as Pathogenic.

Frequency

Genomes: not found (cov: 32)

Consequence

PMS2
NM_000535.7 frameshift, splice_acceptor, missense, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:7

Conservation

PhyloP100: 8.91
Variant links:
Genes affected
PMS2 (HGNC:9122): (PMS1 homolog 2, mismatch repair system component) The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 60 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 7-6005948-CTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-ATTT is Pathogenic according to our data. Variant chr7-6005948-CTTAGACTCAGTACCACCTGCCCAGAGCAAATCTGATGGACTGACTTCCGATCAATAGGTTTGATGGCCTTAGCAGGTTCTGTACTAGAGAAATCA-ATTT is described in ClinVar as [Pathogenic]. Clinvar id is 91341.Status of the report is reviewed_by_expert_panel, 3 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PMS2NM_000535.7 linkc.24-12_107delTGATTTCTCTAGTACAGAACCTGCTAAGGCCATCAAACCTATTGATCGGAAGTCAGTCCATCAGATTTGCTCTGGGCAGGTGGTACTGAGTCTAAGinsAAAT p.Thr9fs frameshift_variant, splice_acceptor_variant, missense_variant, splice_region_variant, intron_variant Exon 2 of 15 ENST00000265849.12 NP_000526.2 P54278-1Q7Z3Q2B4DGM0

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PMS2ENST00000265849.12 linkc.24-12_107delTGATTTCTCTAGTACAGAACCTGCTAAGGCCATCAAACCTATTGATCGGAAGTCAGTCCATCAGATTTGCTCTGGGCAGGTGGTACTGAGTCTAAGinsAAAT p.Thr9fs frameshift_variant, splice_acceptor_variant, missense_variant, splice_region_variant, intron_variant Exon 2 of 15 1 NM_000535.7 ENSP00000265849.7 P54278-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:7
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

not provided Pathogenic:2
Jan 24, 2022
GeneDx
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant involving a canonical splice site reported to result in skipping of exon 2 leading to a null allele in a gene for which loss-of-function is a known mechanism of disease (van der Klift 2010); Observed in individuals with Lynch syndrome (van der Klift 2010, ten Broeke 2015, Suerink 2016); Not observed at significant frequency in large population cohorts (gnomAD); Truncating variants in this gene are considered pathogenic by a well-established clinical consortium and/or database; This variant is associated with the following publications: (PMID: 20186688, 25512458, 26110232) -

Nov 15, 2022
Revvity Omics, Revvity
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Lynch syndrome 4 Pathogenic:2
Apr 29, 2022
Baylor Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Sep 18, 2023
Myriad Genetics, Inc.
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is considered likely pathogenic. This variant occurs within a consensus splice junction and is predicted to result in abnormal mRNA splicing of either an out-of-frame exon or an in-frame exon necessary for protein stability and/or normal function. -

Lynch syndrome Pathogenic:1
Sep 05, 2013
International Society for Gastrointestinal Hereditary Tumours (InSiGHT)
Significance: Pathogenic
Review Status: reviewed by expert panel
Collection Method: research

Coding sequence variation resulting in a stop codon (also interrupts canonical acceptor splice site) -

Hereditary nonpolyposis colorectal neoplasms Pathogenic:1
Oct 21, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant results in the deletion of part of exon 2 (c.24-12_107delinsAAAT) of the PMS2 gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or altered protein product. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of Lynch syndrome (PMID: 20186688). ClinVar contains an entry for this variant (Variation ID: 91341). Studies have shown that this variant results in skipping of exon 2, and produces a non-functional protein and/or introduces a premature termination codon (PMID: 20186688; internal data). For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Jul 14, 2022
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.24-12_107del96insAAAT pathogenic mutation, located in intron 1 and coding exon 2 of the PMS2 gene, results from the deletion of 96 nucleotides and insertion of 4 nucleotides at positions c.24-12 to c.107. RT-PCR analysis demonstrated that this alteration results in out of frame exon skipping (van der Klift HM et al. Hum. Mutat. 2010 May;31(5):578-87). In addition, this alteration was identified in patients with colorectal cancer, as well as in two siblings with congenital mismatch repair deficiency (CMMR-D) who were positive for a second PMS2 mutation in trans (van der Klift HM et al. Hum. Mutat. 2010 May;31(5):578-87; Bougeard G et al. Fam. Cancer. 2014 Mar;13(1):131-5). In silico splice site analysis predicts that this alteration may weaken the native splice acceptor site; however, direct evidence is insufficient at this time (Ambry internal data). In addition to the clinical data presented in the literature, alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1554306445; hg19: chr7-6045579; API