rs1554348955

Variant names:

• chr7-55174830-TGCTTTGCTGTGTGGGGGTCCATGGCTCTGAACCTCAGGCCCACCTTTTCTCATGTCTGGCAGCTGCTCTGCTCTAGACCCTGCTCATCTCCACATCCTAAATGTTCACTTTCTATGTCTTTCCCTTTCTAGCTCTA-T
• rs1554348955
• NM_005228.5:c.2283+12_2283+147del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_005228.5(EGFR):​c.2283+12_2283+147del variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: EGFR NM_005228.5 intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 2.03
• Publications: 0 publications found

Genes affected

EGFR (HGNC:3236): (epidermal growth factor receptor) The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thus inducing receptor dimerization and tyrosine autophosphorylation leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm which contributes to a severe form of Coronavirus Disease 2019 (COVID-19) resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). [provided by RefSeq, Jul 2020]

EGFR Gene-Disease associations (from GenCC):

• lung cancer

  Inheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
• non-small cell lung carcinoma

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• inflammatory skin and bowel disease, neonatal, 2

  Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• neonatal inflammatory skin and bowel disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EGFR	NM_005228.5	c.2283+12_2283+147del		intron_variant	Intron 19 of 27	ENST00000275493.7	NP_005219.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EGFR	ENST00000275493.7	c.2283+11_2283+146del		intron_variant	Intron 19 of 27	1	NM_005228.5	ENSP00000275493.2
EGFR	ENST00000455089.5	c.2148+11_2148+146del		intron_variant	Intron 18 of 25	1		ENSP00000415559.1
EGFR	ENST00000450046.2	c.2124+11_2124+146del		intron_variant	Intron 19 of 27	4		ENSP00000413354.2
EGFR	ENST00000700145.1	c.630+11_630+146del		intron_variant	Intron 6 of 8			ENSP00000514824.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Mar 11, 2013

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554348955; hg19: chr7-55242523;