rs1554382656

Variant names:

• chr7-117548791-TTGGCGGTTGCTGGATCCACTG-ATAGAAA
• rs1554382656
• NM_000492.4:c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1 PM4 PP2

The NM_000492.4(CFTR):​c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA​(p.Leu454_Gly461delinsIleGluArg) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L454L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CFTR NM_000492.4 missense, disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 7.29
• Publications: 0 publications found

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR-AS1 (HGNC:40144): (CFTR antisense RNA 1)

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM1: In a hotspot region, there are 9 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 21 uncertain in NM_000492.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000492.4.
• PP2: Missense variant in the gene, where a lot of missense mutations are associated with disease in ClinVar. The gene has 197 curated pathogenic missense variants (we use a threshold of 10). The gene has 46 curated benign missense variants. Gene score misZ: -3.1397 (below the threshold of 3.09). Trascript score misZ: -1.0868 (below the threshold of 3.09). GenCC associations: The gene is linked to hereditary chronic pancreatitis, cystic fibrosis, congenital bilateral absence of vas deferens.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFTR	NM_000492.4	c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA	p.Leu454_Gly461delinsIleGluArg	missense_variant, disruptive_inframe_deletion		ENST00000003084.11	NP_000483.3
CFTR-AS1	NR_149084.1	n.222-6273_222-6252delCAGTGGATCCAGCAACCGCCAAinsTTTCTAT		intron_variant	Intron 2 of 2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA	p.Leu454_Gly461delinsIleGluArg	missense_variant, disruptive_inframe_deletion		1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

May 05, 2017

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Cystic fibrosis Uncertain:1

Sep 05, 2022

Institute of Human Genetics, University of Leipzig Medical Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

This variant was identified in 1 patient with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PM2_SUP, PM3, PP4 -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554382656; hg19: chr7-117188845;