rs1554382656

Positions:

• chr7-117548790-GTTGGCGGTTGCTGGATCCACTG-GATAGAAA

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1 PM2 PM4

The NM_000492.4(CFTR):​c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA​(p.Leu454_Gly461delinsIleGluArg) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CFTR NM_000492.4 missense, disruptive_inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts U:2
• Conservation: PhyloP100: 7.29

Genes affected

CFTR (HGNC:1884): (CF transmembrane conductance regulator) This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

CFTR-AS1 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM1: In a strand (size 4) in uniprot entity CFTR_HUMAN there are 6 pathogenic changes around while only 0 benign (100%) in NM_000492.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000492.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
CFTR	NM_000492.4	c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA	p.Leu454_Gly461delinsIleGluArg	missense_variant, disruptive_inframe_deletion		ENST00000003084.11	NP_000483.3
CFTR-AS1	NR_149084.1	n.222-6273_222-6252delCAGTGGATCCAGCAACCGCCAAinsTTTCTAT		intron_variant

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
CFTR	ENST00000003084.11	c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA	p.Leu454_Gly461delinsIleGluArg	missense_variant, disruptive_inframe_deletion		1	NM_000492.4	ENSP00000003084.6

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Quest Diagnostics Nichols Institute San Juan Capistrano

May 05, 2017

- -

Cystic fibrosis Uncertain:1

Uncertain significance, criteria provided, single submitter

curation

Institute of Human Genetics, University of Leipzig Medical Center

Sep 05, 2022

This variant was identified in 1 patient with a clinically confirmed diagnosis of cystic fibrosis. The variant was classified in the context of a project re-classifying variants in the German Cystic Fibrosis Registry (Muko.e.V.). Link: https://www.muko.info/angebote/qualitaetsmanagement/register/cf-einrichtungen/mukoweb. Criteria applied: PM2_SUP, PM3, PP4 -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554382656; hg19: chr7-117188845;