rs1554382656
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP2
The NM_000492.4(CFTR):c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA(p.Leu454_Gly461delinsIleGluArg) variant causes a missense, disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L454L) has been classified as Likely benign.
Frequency
Consequence
NM_000492.4 missense, disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000492.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CFTR | MANE Select | c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA | p.Leu454_Gly461delinsIleGluArg | missense disruptive_inframe_deletion | N/A | NP_000483.3 | |||
| CFTR-AS1 | n.222-6273_222-6252delCAGTGGATCCAGCAACCGCCAAinsTTTCTAT | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CFTR | TSL:1 MANE Select | c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA | p.Leu454_Gly461delinsIleGluArg | missense disruptive_inframe_deletion | N/A | ENSP00000003084.6 | P13569-1 | ||
| CFTR | c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA | p.Leu454_Gly461delinsIleGluArg | missense disruptive_inframe_deletion | N/A | ENSP00000514471.1 | A0A8V8TNH2 | |||
| CFTR | c.1360_1381delTTGGCGGTTGCTGGATCCACTGinsATAGAAA | p.Leu454_Gly461delinsIleGluArg | missense disruptive_inframe_deletion | N/A | ENSP00000559265.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at