rs1554441989

Variant names:

• chr7-19116904-A-AGGGCAGCGTGGGGATGATCTT
• rs1554441989
• NM_000474.4:c.397_417dupAAGATCATCCCCACGCTGCCC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PM1 PM2 PM4 PP5_Very_Strong

The NM_000474.4(TWIST1):​c.397_417dupAAGATCATCCCCACGCTGCCC​(p.Pro139_Ser140insLysIleIleProThrLeuPro) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: TWIST1 NM_000474.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:5
• Conservation: PhyloP100: 1.98

Genes affected

TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PM1: In a domain bHLH (size 51) in uniprot entity TWST1_HUMAN there are 15 pathogenic changes around while only 0 benign (100%) in NM_000474.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000474.4.
• PP5: Variant 7-19116904-A-AGGGCAGCGTGGGGATGATCTT is Pathogenic according to our data. Variant chr7-19116904-A-AGGGCAGCGTGGGGATGATCTT is described in ClinVar as [Pathogenic]. Clinvar id is 458686.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
TWIST1	NM_000474.4	c.397_417dupAAGATCATCCCCACGCTGCCC	p.Pro139_Ser140insLysIleIleProThrLeuPro	conservative_inframe_insertion	Exon 1 of 2	ENST00000242261.6	NP_000465.1
TWIST1	NR_149001.2	n.712_732dupAAGATCATCCCCACGCTGCCC		non_coding_transcript_exon_variant	Exon 1 of 3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
TWIST1	ENST00000242261.6	c.397_417dupAAGATCATCCCCACGCTGCCC	p.Pro139_Ser140insLysIleIleProThrLeuPro	conservative_inframe_insertion	Exon 1 of 2	1	NM_000474.4	ENSP00000242261.5
TWIST1	ENST00000354571.5	n.193_213dupAAGATCATCCCCACGCTGCCC		non_coding_transcript_exon_variant	Exon 1 of 3	2		ENSP00000346582.5
TWIST1	ENST00000443687.5	n.-3_18dupAAGATCATCCCCACGCTGCCC		non_coding_transcript_exon_variant	Exon 1 of 4	4		ENSP00000416986.1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 6.84e-7 AC: 1 AN: 1461836 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 727230

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 8.99e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:5

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

TWIST1-related craniosynostosis Pathogenic:2

-

Clinical Laboratory Sciences Program (CLSP), King Saud bin Abdulaziz University for Health Sciences (KSAU-HS)

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Mar 10, 2023

Johns Hopkins Genomics, Johns Hopkins University

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This TWIST1 variant has been reported in multiple unrelated individuals with TWIST1-related disorders, including as a de novo occurrence. This variant is absent from a large population dataset but has been reported in ClinVar (Variation ID 458686). Bioinformatic analysis predicts that this in-frame duplication variant would not affect normal exon 1 splicing7, although this has not been confirmed experimentally to our knowledge. The amino acids involved in the duplication are evolutionarily conserved across most of the species assessed. We consider c.397_417dup; p.Lys133_Pro139dup in TWIST1 to be pathogenic. -

not provided Pathogenic:1

Oct 27, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

In-frame duplication of 7 amino acids in a non-repeat region; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 10749989, 30074960, 17621648, 11248247, 16251895, 31754721, 33937142, 16838304, 8988167) -

Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis Pathogenic:1

Mar 01, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.397_417dup, results in the insertion of 7 amino acid(s) of the TWIST1 protein (p.Lys133_Pro139dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of craniosynostosis (PMID: 8988167; Invitae). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 458686). For these reasons, this variant has been classified as Pathogenic. -

Saethre-Chotzen syndrome Pathogenic:1

Jun 14, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.397_417dup, results in the insertion of 7 amino acids to the TWIST1 protein (p.Lys133_Pro139dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has been reported in individuals affected with craniosynostosis and was observed to arise de novo in one case (PMID: 8988167, 16838304). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. This insertion is located within the conserved loop region of the basic helix-loop-helix (bHLH) domain of the TWIST1 protein. The bHLH domain is essential for protein dimerization and DNA-binding (PMID: 11992718). Four different 7 amino acid in-frame duplications in the loop region have been reported in affected individuals (PMID: 24127277, 16251895, 14513358), which suggests that insertions in this region are deleterious. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554441989; hg19: chr7-19156527;