rs1554441991

Variant names:

• chr7-19116905-G-GGGCAGCGTGGGGATGATCTTC
• rs1554441991
• NM_000474.4:c.396_416dupGAAGATCATCCCCACGCTGCC

Variant summary

Our verdict is Pathogenic. The variant received 13 ACMG points: 13P and 0B. PM1 PM4 PP3 PP5_Very_Strong

The NM_000474.4(TWIST1):​c.396_416dupGAAGATCATCCCCACGCTGCC​(p.Pro139_Ser140insLysIleIleProThrLeuPro) variant causes a disruptive inframe insertion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: TWIST1 NM_000474.4 disruptive_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 9.83
• Publications: 2 publications found

Genes affected

TWIST1 (HGNC:12428): (twist family bHLH transcription factor 1) This gene encodes a basic helix-loop-helix (bHLH) transcription factor that plays an important role in embryonic development. The encoded protein forms both homodimers and heterodimers that bind to DNA E box sequences and regulate the transcription of genes involved in cranial suture closure during skull development. This protein may also regulate neural tube closure, limb development and brown fat metabolism. This gene is hypermethylated and overexpressed in multiple human cancers, and the encoded protein promotes tumor cell invasion and metastasis, as well as metastatic recurrence. Mutations in this gene cause Saethre-Chotzen syndrome in human patients, which is characterized by craniosynostosis, ptosis and hypertelorism. [provided by RefSeq, Jul 2020]

TWIST1 Gene-Disease associations (from GenCC):

• Saethre-Chotzen syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, G2P, Orphanet, Laboratory for Molecular Medicine
• TWIST1-related craniosynostosis

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp, ClinGen
• isolated brachycephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated plagiocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• isolated scaphocephaly

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Sweeney-Cox syndrome

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Pathogenic. The variant received 13 ACMG points.

• PM1: In a hotspot region, there are 8 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 7 uncertain in NM_000474.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000474.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 7-19116905-G-GGGCAGCGTGGGGATGATCTTC is Pathogenic according to our data. Variant chr7-19116905-G-GGGCAGCGTGGGGATGATCTTC is described in ClinVar as Pathogenic. ClinVar VariationId is 543075.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000474.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TWIST1	NM_000474.4	MANE Select	c.396_416dupGAAGATCATCCCCACGCTGCC	p.Pro139_Ser140insLysIleIleProThrLeuPro	disruptive_inframe_insertion	Exon 1 of 2	NP_000465.1	Q15672
	TWIST1	NR_149001.2		n.711_731dupGAAGATCATCCCCACGCTGCC		non_coding_transcript_exon	Exon 1 of 3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TWIST1	ENST00000242261.6	TSL:1 MANE Select	c.396_416dupGAAGATCATCCCCACGCTGCC	p.Pro139_Ser140insLysIleIleProThrLeuPro	disruptive_inframe_insertion	Exon 1 of 2	ENSP00000242261.5	Q15672
	TWIST1	ENST00000354571.5	TSL:2	n.192_212dupGAAGATCATCCCCACGCTGCC		non_coding_transcript_exon	Exon 1 of 3	ENSP00000346582.5	H7BY00
	TWIST1	ENST00000443687.5	TSL:4	n.-4_17dupGAAGATCATCCCCACGCTGCC		non_coding_transcript_exon	Exon 1 of 4	ENSP00000416986.1	H7C4D7

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome Cov.: 32

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
2	-	-	not provided (2)
1	-	-	Saethre-Chotzen syndrome;C4551902:TWIST1-related craniosynostosis (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.8
Mutation Taster		=36/62	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554441991; hg19: chr7-19156528;