rs1554507014

chr8-17723280-TATATTAGTCCTATTACACAAAATCTAGCATCCAAAGATTCCACAGGAGATAGTCTTTTGCAAAGTAAATGAAACTGAAATAATCTTTTTTTCTGATTCCAGTTAGAGTCCAAATCCCCTGGGTTGCTACTCTTAAACCTCCAAAACACCATCACTTCAGACGATGCACTTTCGAATCCTTCATGCAAAAATATACTTTAACACATAATTATTTCAAGAGTGTTTTTCAAAGAATTTTTTTTCTGCCAAACTTTCAGAGCAACTCCAAGGAAGCAGTATGCCTATTTTTCCTGAAACCCCAGAAACAAAAATTCTAATTATTTGCAGAGCATTAGTTTTTCTTGTAATGACTGTTTCCACAACCCCCGAAGTGTGATATAAAGTCGACTTACAATTGTTGCTGTAAGTGCTCAGCTCACTGTGGGTGCTGGCTATTGAGGGGGTGCTTCCTGTCCTCCGCAGCGCAGGACTTTTCAAAGATGCTTTGGATTTAGGAAGTGGTCTAGGCAAATTCACCCATGACGACTGTGCAGTTTTCAAGGATGTAGGCTTTCCTTGGGGTTTAAAAAAAACAAAAAGTTTCCAGTGCTATTCATCCCGAAAGCTGGCACTTTTTAAGCCTGTAAACTCAAACTTCTGCACTAACAACAAAGTCAAAACACAAA-T

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PVS1_Moderate

The NM_001363059.2(MTUS1):c.2288-111_2449+391del variant causes a splice acceptor, splice donor, splice donor 5th base, coding sequence, intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MTUS1 NM_001363059.2 splice_acceptor, splice_donor, splice_donor_5th_base, coding_sequence, intron
• Clinical Significance: not provided no classification provided O:2
• Conservation: PhyloP100: 1.54

Genes affected

MTUS1 (HGNC:29789): (microtubule associated scaffold protein 1) This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PVS1: Splicing variant, NOT destroyed by nmd, known LOF gene, truncates exone, which is 0.04222397 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
MTUS1	NM_001363059.2	c.2288-111_2449+391del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	4/15	ENST00000693296.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
MTUS1	ENST00000693296.1	c.2288-111_2449+391del		splice_acceptor_variant, splice_donor_variant, splice_donor_5th_base_variant, coding_sequence_variant, intron_variant	4/15		NM_001363059.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:2

Revision: no classification provided

Submissions by phenotype

Large for gestational age Other:1

not provided, no classification provided

case-control

Institute of Molecular and Cell Biology, University of Tartu

-

- -

Normal pregnancy Other:1

not provided, no classification provided

case-control

Institute of Molecular and Cell Biology, University of Tartu

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554507014; hg19: chr8-17580789;