rs1554507029

Variant names:

• chr8-17723281-ATATTAGTCCTATTACACAAAATCTAGCATCCAAAGATTCCACAGGAGATAGTCTTTTGCAAAGTAAATGAAACTGAAATAATCTTTTTTTCTGATTCCAGTTAGAGTCCAAATCCCCTGGGTTGCTACTCTTAAACCTCCAAAACACCATCACTTCAGACGATGCACTTTCGAATCCTTCATGCAAAAATATACTTTAACACATAATTATTTCAAGAGTGTTTTTCAAAGAATTTTTTTTCTGCCAAACTTTCAGAGCAACTCCAAGGAAGCAGTATGCCTATTTTTCCTGAAACCCCAGAAACAAAAATTCTAATTATTTGCAGAGCATTAGTTTTTCTTGTAATGACTGTTTCCACAACCCCCGAAGTGTGATATAAAGTCGACTTACAATTGTTGCTGTAAGTGCTCAGCTCACTGTGGGTGCTGGCTATTGAGGGGGTGCTTCCTGTCCTCCGCAGCGCAGGACTTTTCAAAGATGCTTTGGATTTAGGAAGTGGTCTAGGCAAATTCACCCATGACGACTGTGCAGTTTTCAAGGATGTAGGCTTTCCTTGGGGTTTAAAAAAAACAAAAAGTTTCCAGTGCTATTCATCCCGAAAGCTGGCACTTTTTAAGCCTGTAAACTCAAACTTCTGCACTAACAACAAAGTCAAAACACAAAATGAATGTTCACAATCATGTAACTTCAGATGAAAGATGAAAGCTTCACGCAGACATGTTTATTTTTGATCATTTAGAGGCAAGAGAGCAGAAATGATGAGGCAATTAGGATATGAGAAGTGTAGGAGTAACCCTGTCTCCTAAAGTAATTAACTCACACATGTTCTCTGAAGGAGATGATCAATCAGAATAATCATGAGAAAGCAGCTTTTGGCAAAACTGAAATAAAAAAATAAACAAATTGATAC-A
• rs1554507029
• ENST00000520196.5:n.1490-29_*197+390del

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The ENST00000520196.5(MTUS1):​n.1490-29_*197+390del variant causes a exon loss change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: MTUS1 ENST00000520196.5 exon_loss
• Clinical Significance: not provided no classification provided O:2
• Conservation: PhyloP100: 1.54
• Publications: 0 publications found

Genes affected

MTUS1 (HGNC:29789): (microtubule associated scaffold protein 1) This gene encodes a protein which contains a C-terminal domain able to interact with the angiotension II (AT2) receptor and a large coiled-coil region allowing dimerization. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the transcript variants has been shown to encode a mitochondrial protein that acts as a tumor suppressor and partcipates in AT2 signaling pathways. Other variants may encode nuclear or transmembrane proteins but it has not been determined whether they also participate in AT2 signaling pathways. [provided by RefSeq, Jul 2008]

ENSG00000301996 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MTUS1	NM_001363059.2	c.2288-358_2449+390del		exon_loss_variant, splice_acceptor_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 15	ENST00000693296.1	NP_001349988.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MTUS1	ENST00000693296.1	c.2288-358_2449+390del		exon_loss_variant, splice_acceptor_variant, splice_donor_variant, splice_region_variant, intron_variant	Exon 4 of 15		NM_001363059.2	ENSP00000509719.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: not provided

Submissions summary: Other:2

Revision: no classification provided

Submissions by phenotype

Gestational diabetes mellitus uncontrolled Other:1

-

Institute of Molecular and Cell Biology, University of Tartu

Significance: not provided

Review Status: no classification provided

Collection Method: case-control

- -

Normal pregnancy Other:1

-

Institute of Molecular and Cell Biology, University of Tartu

Significance: not provided

Review Status: no classification provided

Collection Method: case-control

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554507029; hg19: chr8-17580790;