rs1554541834

Variant names:

• chr8-71299174-TGAGCTGTTATAATACTGTGCGTACTGACCCTGGCCAAAACTGGGATAAGACGGATAGTCCTACCAAATCAAACC-T
• rs1554541834
• NM_000503.6:c.640-15_698delGGTTTGATTTGGTAGGACTATCCGTCTTATCCCAGTTTTGGCCAGGGTCAGTACGCACAGTATTATAACAGCTC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000503.6(EYA1):​c.640-15_698delGGTTTGATTTGGTAGGACTATCCGTCTTATCCCAGTTTTGGCCAGGGTCAGTACGCACAGTATTATAACAGCTC​(p.Asp214fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: EYA1 NM_000503.6 frameshift, splice_acceptor, splice_region, intron
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 7.61
• Publications: 0 publications found

Genes affected

EYA1 (HGNC:3519): (EYA transcriptional coactivator and phosphatase 1) This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]

EYA1 Gene-Disease associations (from GenCC):

• branchio-oto-renal syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
• branchiootorenal syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae)
• branchiootic syndrome 1

  Inheritance: AD Classification: STRONG Submitted by: PanelApp Australia
• branchiootic syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 8-71299174-TGAGCTGTTATAATACTGTGCGTACTGACCCTGGCCAAAACTGGGATAAGACGGATAGTCCTACCAAATCAAACC-T is Pathogenic according to our data. Variant chr8-71299174-TGAGCTGTTATAATACTGTGCGTACTGACCCTGGCCAAAACTGGGATAAGACGGATAGTCCTACCAAATCAAACC-T is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 459256.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EYA1	NM_000503.6	c.640-15_698delGGTTTGATTTGGTAGGACTATCCGTCTTATCCCAGTTTTGGCCAGGGTCAGTACGCACAGTATTATAACAGCTC	p.Asp214fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 9 of 18	ENST00000340726.8	NP_000494.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EYA1	ENST00000340726.8	c.640-15_698delGGTTTGATTTGGTAGGACTATCCGTCTTATCCCAGTTTTGGCCAGGGTCAGTACGCACAGTATTATAACAGCTC	p.Asp214fs	frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant	Exon 9 of 18	1	NM_000503.6	ENSP00000342626.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Melnick-Fraser syndrome Pathogenic:1

Apr 14, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 459256). This variant is also known as a deletion starting in intron 6 and extending into exon 7. This variant has been observed in individuals with EYA1-related conditions (PMID: 12404110; Invitae). This variant is not present in population databases (gnomAD no frequency). This variant results in the deletion of the intron 8 - exon 9 junction (c.640-15_698del) of the EYA1 gene. It is expected to disrupt RNA splicing. Variants that disrupt the donor or acceptor splice site typically lead to a loss of protein function (PMID: 16199547), and loss-of-function variants in EYA1 are known to be pathogenic (PMID: 10464653, 18220287). -

not provided Pathogenic:1

Aug 01, 2022

GeneDx

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant predicted to result in a null allele in a gene for which loss-of-function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 8092198, 1478663, 12404110) -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.6
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554541834; hg19: chr8-72211409;