rs1554601502

Variant names:

• chr8-118110377-CAGTACTGATGCTGGCTTTGGCCAGCATCGCCTGGCCGATGTCAAACCCCACGTCCTCGGTGTAGTCAGGCCA-C
• rs1554601502
• NM_000127.3:c.598_669delTGGCCTGACTACACCGAGGACGTGGGGTTTGACATCGGCCAGGCGATGCTGGCCAAAGCCAGCATCAGTACT

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM2 PM4 PP3 PP5_Moderate

The NM_000127.3(EXT1):​c.598_669delTGGCCTGACTACACCGAGGACGTGGGGTTTGACATCGGCCAGGCGATGCTGGCCAAAGCCAGCATCAGTACT​(p.Trp200_Thr223del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: EXT1 NM_000127.3 conservative_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.24

Genes affected

EXT1 (HGNC:3512): (exostosin glycosyltransferase 1) This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000127.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 8-118110377-CAGTACTGATGCTGGCTTTGGCCAGCATCGCCTGGCCGATGTCAAACCCCACGTCCTCGGTGTAGTCAGGCCA-C is Pathogenic according to our data. Variant chr8-118110377-CAGTACTGATGCTGGCTTTGGCCAGCATCGCCTGGCCGATGTCAAACCCCACGTCCTCGGTGTAGTCAGGCCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 456064.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EXT1	NM_000127.3	c.598_669delTGGCCTGACTACACCGAGGACGTGGGGTTTGACATCGGCCAGGCGATGCTGGCCAAAGCCAGCATCAGTACT	p.Trp200_Thr223del	conservative_inframe_deletion	Exon 1 of 11	ENST00000378204.7	NP_000118.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EXT1	ENST00000378204.7	c.598_669delTGGCCTGACTACACCGAGGACGTGGGGTTTGACATCGGCCAGGCGATGCTGGCCAAAGCCAGCATCAGTACT	p.Trp200_Thr223del	conservative_inframe_deletion	Exon 1 of 11	1	NM_000127.3	ENSP00000367446.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Multiple congenital exostosis Pathogenic:1

Jul 14, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.598_669del, results in the deletion of 24 amino acids of the EXT1 protein (p.Trp200_Thr223del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with EXT1-related disease. However, smaller in-frame deletions (c.644_664del and c.653_661del) have been reported in individuals affected with multiple osteochondromas (PMID: 19810120). This suggests that deletion of this region of the EXT1 protein is causative of disease. For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554601502; hg19: chr8-119122616;