rs1554747479

Positions:

• chr8-133238971-CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG-C
• chr8-133238971-CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG-CGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGGGAGCGGCTGCGGGTGCCCTCGCTGGTGTGGGAGCGGCTTCGGGTGCCCTCGCTGGTGTGG

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2 PM4

The NM_006096.4(NDRG1):​c.1032_1091del​(p.Thr350_Gly369del) variant causes a inframe deletion change. The variant allele was found at a frequency of 0.000000697 in 1,435,572 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 7.0e-7 (0 hom.)
• Consequence: NDRG1 NM_006096.4 inframe_deletion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 6.18

Genes affected

NDRG1 (HGNC:7679): (N-myc downstream regulated 1) This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein involved in stress responses, hormone responses, cell growth, and differentiation. The encoded protein is necessary for p53-mediated caspase activation and apoptosis. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4D, and expression of this gene may be a prognostic indicator for several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]

ACMG classification

Verdict is Uncertain_significance. Variant got 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_006096.4.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	UniProt
NDRG1	NM_006096.4	c.1032_1091del	p.Thr350_Gly369del	inframe_deletion	16/16	ENST00000323851.13

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Appris	UniProt
NDRG1	ENST00000323851.13	c.1032_1091del	p.Thr350_Gly369del	inframe_deletion	16/16	1	NM_006096.4	P1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.97e-7 AC: 1 AN: 1435572 Hom.: 0 AF XY: 0.00000141 AC XY: 1 AN XY: 711474

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 9.09e-7

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Charcot-Marie-Tooth disease type 4 Uncertain:1

Uncertain significance, criteria provided, single submitter

clinical testing

Invitae

Oct 14, 2021

This variant, c.1032_1091del, results in the deletion of 20 amino acid(s) of the NDRG1 protein (p.Thr350_Gly369del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals affected with NDRG1-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1554747479; hg19: chr8-134251214;