rs1554784508

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_001177316.2(SLC34A3):​c.1093+41_1094-15delAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGCTGGCCAGGGCTGACCC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000131 in 152,098 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: 𝑓 0.000013 ( 0 hom., cov: 31)
Exomes 𝑓: 0.000045 ( 0 hom. )
Failed GnomAD Quality Control

Consequence

SLC34A3
NM_001177316.2 intron

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 1.45

Publications

2 publications found
Variant links:
Genes affected
SLC34A3 (HGNC:20305): (solute carrier family 34 member 3) This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
SLC34A3 Gene-Disease associations (from GenCC):
  • hereditary hypophosphatemic rickets with hypercalciuria
    Inheritance: SD, AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

PP5
Variant 9-137234300-GTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC-G is Pathogenic according to our data. Variant chr9-137234300-GTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 1435.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SLC34A3NM_001177316.2 linkc.1093+41_1094-15delAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGCTGGCCAGGGCTGACCC intron_variant Intron 10 of 12 ENST00000673835.1 NP_001170787.2 Q8N130

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SLC34A3ENST00000673835.1 linkc.1093+25_1094-31delTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC intron_variant Intron 10 of 12 NM_001177316.2 ENSP00000501114.1 Q8N130
SLC34A3ENST00000361134.2 linkc.1093+25_1094-31delTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC intron_variant Intron 10 of 12 2 ENSP00000355353.2 Q8N130
SLC34A3ENST00000538474.5 linkc.1093+25_1094-31delTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC intron_variant Intron 10 of 12 5 ENSP00000442397.1 Q8N130
SLC34A3ENST00000673865.1 linkc.*59_*143delTGGCCAGGGCTGACCCAGCATCCCCCATAGACTTCCCCTTCCCACCAGGCTGACTCGGGGGCTACCTGGCCCTCCTTGTGGGCGC downstream_gene_variant ENSP00000501101.1 A0A669KB63

Frequencies

GnomAD3 genomes
AF:
0.0000131
AC:
2
AN:
152098
Hom.:
0
Cov.:
31
show subpopulations
Gnomad AFR
AF:
0.00
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.0000294
Gnomad OTH
AF:
0.00
GnomAD4 exome
Data not reliable, filtered out with message: AS_VQSR
AF:
0.0000453
AC:
66
AN:
1456214
Hom.:
0
AF XY:
0.0000511
AC XY:
37
AN XY:
724536
show subpopulations
⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
33454
American (AMR)
AF:
0.0000897
AC:
4
AN:
44612
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
26080
East Asian (EAS)
AF:
0.00
AC:
0
AN:
39646
South Asian (SAS)
AF:
0.00
AC:
0
AN:
86064
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
48982
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
5768
European-Non Finnish (NFE)
AF:
0.0000531
AC:
59
AN:
1111386
Other (OTH)
AF:
0.0000498
AC:
3
AN:
60222
⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.399
Heterozygous variant carriers
0
4
8
13
17
21
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
4
8
12
16
20
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
AF:
0.0000131
AC:
2
AN:
152098
Hom.:
0
Cov.:
31
AF XY:
0.0000269
AC XY:
2
AN XY:
74292
show subpopulations
⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
African (AFR)
AF:
0.00
AC:
0
AN:
41402
American (AMR)
AF:
0.00
AC:
0
AN:
15282
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
3468
East Asian (EAS)
AF:
0.00
AC:
0
AN:
5184
South Asian (SAS)
AF:
0.00
AC:
0
AN:
4834
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
10626
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
316
European-Non Finnish (NFE)
AF:
0.0000294
AC:
2
AN:
67982
Other (OTH)
AF:
0.00
AC:
0
AN:
2092
⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000203), which strongly suggests a high chance of mosaicism in these individuals.
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.375
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Genome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Autosomal recessive hypophosphatemic bone disease Pathogenic:1
Oct 01, 2006
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.5
Mutation Taster
=37/63
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554784508; hg19: chr9-140128752; API