rs1554820012

Variant names:

• chr10-53822383-GGGAGGAGGACAAAAAAGAGAAAAAGGAGAAATGTCAGGAGGAGGAGCAAGAGGAGCAGGAGCA-G
• rs1554820012
• NM_033056.4:c.5280_5342delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC

Variant summary

Our verdict is Benign. The variant received -9 ACMG points: 0P and 9B. BP3 BP6_Very_Strong

The NM_033056.4(PCDH15):​c.5280_5342delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC​(p.Ala1761_Pro1781del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000206 in 1,572,742 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★). Synonymous variant affecting the same amino acid position (i.e. P1760P) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0012 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000099 (0 hom.)
• Consequence: PCDH15 NM_033056.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:5
• Conservation: PhyloP100: 2.97
• Publications: 0 publications found

Genes affected

PCDH15 (HGNC:14674): (protocadherin related 15) This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]

PCDH15 Gene-Disease associations (from GenCC):

• autosomal recessive nonsyndromic hearing loss 23

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
• Usher syndrome type 1

  Inheritance: AR, Unknown Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Usher syndrome type 1F

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -9 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_033056.4
• BP6: Variant 10-53822383-GGGAGGAGGACAAAAAAGAGAAAAAGGAGAAATGTCAGGAGGAGGAGCAAGAGGAGCAGGAGCA-G is Benign according to our data. Variant chr10-53822383-GGGAGGAGGACAAAAAAGAGAAAAAGGAGAAATGTCAGGAGGAGGAGCAAGAGGAGCAGGAGCA-G is described in ClinVar as Likely_benign. ClinVar VariationId is 179750.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_033056.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCDH15	NM_033056.4	MANE Plus Clinical	c.5280_5342delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC	p.Ala1761_Pro1781del	disruptive_inframe_deletion	Exon 33 of 33	NP_149045.3
	PCDH15	NM_001384140.1	MANE Select	c.4368-2216_4368-2154delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC		intron	N/A	NP_001371069.1	Q96QU1-7
	PCDH15	NM_001142763.2		c.5301_5363delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC	p.Ala1768_Pro1788del	disruptive_inframe_deletion	Exon 35 of 35	NP_001136235.1	A2A3D8

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PCDH15	ENST00000320301.11	TSL:1 MANE Plus Clinical	c.5280_5342delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC	p.Ala1761_Pro1781del	disruptive_inframe_deletion	Exon 33 of 33	ENSP00000322604.6	Q96QU1-1
	PCDH15	ENST00000644397.2	MANE Select	c.4368-2216_4368-2154delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC		intron	N/A	ENSP00000495195.1	Q96QU1-7
	PCDH15	ENST00000395445.6	TSL:1	c.4388+4947_4388+5009delTGCTCCTGCTCCTCTTGCTCCTCCTCCTGACATTTCTCCTTTTTCTCTTTTTTGTCCTCCTCC		intron	N/A	ENSP00000378832.2	Q96QU1-4

Frequencies

GnomAD3 genomes AF: 0.00121 AC: 183 AN: 151128 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00439

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000663

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000295

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000319 AC: 58 AN: 182056 AF XY: 0.000225

Gnomad AFR exome AF: 0.00520

Gnomad AMR exome AF: 0.0000371

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000992 AC: 141 AN: 1421496 Hom.: 0 AF XY: 0.0000895 AC XY: 63 AN XY: 703916

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00371 AC: 119 AN: 32070

American (AMR) AF: 0.000184 AC: 7 AN: 38012

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25608

East Asian (EAS) AF: 0.00 AC: 0 AN: 36862

South Asian (SAS) AF: 0.00 AC: 0 AN: 82750

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51106

Middle Eastern (MID) AF: 0.000356 AC: 2 AN: 5624

European-Non Finnish (NFE) AF: 0.00000275 AC: 3 AN: 1090526

Other (OTH) AF: 0.000170 AC: 10 AN: 58938

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00121 AC: 183 AN: 151246 Hom.: 0 Cov.: 32 AF XY: 0.00104 AC XY: 77 AN XY: 73868

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00437 AC: 180 AN: 41152

American (AMR) AF: 0.0000662 AC: 1 AN: 15110

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5142

South Asian (SAS) AF: 0.00 AC: 0 AN: 4786

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10464

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 294

European-Non Finnish (NFE) AF: 0.0000295 AC: 2 AN: 67830

Other (OTH) AF: 0.00 AC: 0 AN: 2092

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.000334 Hom.: 0

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not provided (2)
-	-	1	not specified (1)
-	-	1	PCDH15-related disorder (1)
-	-	1	Usher syndrome type 1F (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.0
Mutation Taster		=121/79	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554820012; hg19: chr10-55582143;